Enter Still Water...

2009-02-10T05:34:00.000-08:00

this video is dedicated to my 2 new stalker-fans Ezo and Ming!!!!
and their.. small penises!!!!

2008-08-31T19:59:00.002-07:00

wow.. ok..
still stoned... from this movie i watched last night.. and i must say, t'was a good watch.. a great one... prolly the best feature film made in this new millenia.. everybody should watch it...! they do! they must!

but first.. this blog.. this blog be no more... suda mati larh... ive got heaps to say.. in this little mind of mine, i think far more then the average person does.. and if them words in my head be translated onto this blog, then it will be an interesting read indeed.. however words only fly in when i stare out the window, of a train or a tram, or a car or out the window of this cosy, smelly little attic of mine... and they seem to be lost once i gaze into the largest window of all.. the pc monitor..

Much ado about nothing

2008-08-31T19:59:00.001-07:00

UPDATED!!
WOOOT!1
about.. nothing.. :D

2008-07-02T04:56:00.001-07:00

stewpid...
dota ith schoo stewpid...

2008-05-28T11:32:00.000-07:00

TOMORROW!!!!!!!!!!!!!!!
TOMORROW I SIGN UP FOR YOGA!!!

2008-05-21T09:36:00.001-07:00

Wow.. i have a blog???

2008-05-21T09:34:00.000-07:00

TONIGHT!!!!!!!!!!
THE RED SQUARE(The Kremlin) BE COVERED IN BLUE!!!
TONIGHT!!! TONIGHT!! WOOOOOOT!!!
(overexcited)

HOLA!

2008-03-10T23:43:00.000-07:00

Greetings from goin' down quinsville! Okay maybe it should be greetings from Enter Still Water but since I'll be guest blogging, and I am sterces-ytrid so yes, HELLO TO YOU.

For those of you who don't know who I am, I also don't know how to introduce my cyberself without sounding like I'm trying to promote my own blog so unless Wilson actually tells you who I am, I guess you won't find out. =/

Our dear WilZC is stuck somewhere within reality and fantasy *surprise surprise* so I'm helping him keep this little site alive rather than keeping it here wasting webspace!

Work has been hard. So all you kiddies out there, please enjoy university life because one day when you come out you will regret if you suddenly realise you didn't enjoy enough. Okay okay I'll stop nagging.

Ok imma go back to work.

Hello little brother, misss youuu! <3

PIKAPIKA!!!!!!!

2008-02-21T20:19:00.000-08:00

Got this from Joey's webbie!!
fucking hilarious!!!!!!!!!!!!!!

Singapore Trip 2008!!

2008-02-19T05:11:00.000-08:00

Dear diary (lil girl voice narration lol!!)
Went to Singapore some few weeks back and t'was a blast... sort of... since tashna's stay in malaysia was rather brief... we (being myself, pei lin, and ken han) took a bus down to singapore instead! to meet tash and meng tat! A trip to singapore was long overdue i guess, coz i havent been there in some time.. soem very long time. Busride was fine... First Coach aint bad at all!! in fact! i rather spend 8 hours on in then 8hours on MAS airplanes!!

As per planned, Ken Han and me would bunk at meng tat's aunt's house (joined by meng tat of course). And her aunt was gracious and kind enough to acomodate us both! At first, the plan seemed jusssssssst a lil dodgy, we had 2 alternatives, Meng Tat's brother's or his aunt's place.. MT's brother's house was obviously preferred by us both but meng tat insisted his aunt's place would be far more accessible to palces not to mention a taad more comfy. we followed along. Little did we know, the aunt;s place The Carribean @ Habour Front would be one of the more... luxurious places in town!!! fuckkk man... the unit is just about 6 fucking million sing dollars!! IT HAS EVERYTHING!!! A few beautiful swimming pools of various sizes, a waterway/canal connected to the sea, a good dozen sheltered BBQ areas by the canal, full-on gym. and even 7-11!! and ... the unit itself is splendid. The whole floor beyond the elevator door would be the apartment, well furnished and spacious. If that's my bachelors pad, WOOHOO!! :P Pei Lin, sadly, stayed wif tashie!1 muahahha :P

That aside, first day.. well .. wow.. first day or first night! FIRST ACTIVITY actually!! clubbin!! wtf... at Zouk/Phuture, joined by my long lost friend Han, and his buddies. T'was retro night and....... WADAFARK!!! the two level'd podium was .. just... full of.. GUYS!! like.. farking nerdy looking 26year olds.. dancing to the retro song beats... with nearly identical, almost rehearsed moves... (some of the more.... errr.. non-masculine moves). And the others seem to be enjoying themselves, even the not-soo-looser looking girls n guys.. i just felt really uncomfortable to say the least.. roflol.... so.. well.. took a few piccas.. then left.. for supper.. MAMAK!! WADAFARKDOTCOM!!! mamak in singapore is porbably the worst place on earth to find food!! I ordered Maggie Goreng and KH got nasi goreng. BOTH dishes were.. precariously red in colour. im like why on earth... how on earth.. wha.. whats with the red colour? well anywayz, nasi goreng tasted like nasi putih terbakar... and my maggie was slightly better .. because maggie noodles have some sorta flabour by itself... horrible stuff, quite frankly... i'd be able to cook better nasi goreng with my eyes closed...

Pei lin... drunk and horny

Pei lin and han

Groupshot without cameraman :(

Pei n Tash

Meng Tat and purple

Trio drinking

Wargh!! alchoholic

Me xoxoxo

tepii skit!, perempuan ini sudah mabuk

All fun and smiles, till i tasted the noodles..

Next daayy, what did we do next day ar?? I demanded a visit to Tashna's uni, SMU, for a look-see!! and so we did!! WOW!! SMU girls are.. like.. of a different breed!! like fark!! most of them are above average good looking!!!!!! RAWR!! *controls the little bugger pushing its way out*... Then to Canele, to try some desserts reccomended by Susu. Was ookaay only laaaaaarh... Then some shopping!.. then some rest (and basketballing wif ken han)

Tashna's bitchy SMU face (the one she uses whenever she's mistreated by the hot chicks at SMU)

I am God, fuck u too

Canele

JupiteR?

Zoo's up next! spent almost the entire day at the zoo. Its rather pricey!! but we went both the regular day zoo and the night safari, which.. isnt thaaaat great anyway. But! here are the piccas (spent alot of time camwhoring).

Zooshot

Emoshot

This picture... :D is.. sooooooo bad :D

Best rump in singapore

:P

Some fatass python

Big Inuka

=X

Emo bois

..........

So.. the next day was... err.. argh.. i'll save them for another post.. aint got no more blogstamina....

CNY Emergency!!!

2008-02-08T20:29:00.000-08:00

I personally... think that.. the Chinese New Year celebrations are probably the most destructive of festivities (towards ourselves, others, the environment etc etc)!!! in the first 3 days of the Chinese Lunar New Year... the planet will cringe and cry out in pain!!!

- The food consumed during the 3 days would coerce any personal dietician to commit suicide.... especially if u celebrate CNY in Penang!!

- The amount of paper wasted on ang pow packets would destroy forestsssssssss... (and COME ON!! if ya gonna cut down tree after tree.. at least fucking give 10bux inside teh packet!! measly 2 dollars isnt worth a tree!!! :P )

- Thousands of cute little piglets will get slaughtered and served roasted as a whole on CNY tables (not that im complaining bbbutttttt). in fact i think more livestock are killed in these 3 days then an entire ordinary month!!

- The fucking rubbish generated by the festivities.. (coke cans, beer cans, chrysanthemum drink boxes, wrappers, POLYSTYRENE CUPS/PLATES, UNFINISHED, LEFTOVER FOOD!! paper decorations, and pows, etc etc)

- The polution caused by firecrackers n fireworks.... and the debris left over by - them...

- Also not forgetting the potential fire hazard and injuries caused by the aforementioned toys??

- Somehow it also gets fucking hot during these times ergo.. after eating.. 70% of us sleeep!!! 20% finds somewhere comfy to rest, sms friends then fall asleep, 9% watch TV then doze off slowly when the channels are ovverun by horribly out of tuned new year songs sung by lousy actor-singers. 1% are the hopeless fat fucks that ... go on search for more food...

Sigh, not that I dont like CNY, i love it.. tis tradition!!! but... i somehow feel for the earth too :S perhaps theres a solution... perhaps others would feel it too.... anywayz bargh.. too much talking...
BRB.. ima..... go... find some food :D

2008-02-05T02:15:00.000-08:00

Status : Away
Location : Penang
Duration : dunno... till next monday
Weather : fucking bad

ps : Happy CNY folks!!! (and hapy holidays to rames for his pre-emptive wishes)

Tal Ben-Haim

2008-02-02T08:58:00.000-08:00

Do you think... that i think Tal Ben-Haim fucking sucks????

Well.. yes i do... i think he fucking sucks...

He's just about the worst player ever played for Chelsea in the many many years ive supported them.... right behind Steve Sidwell, Winston Bogarde and Samuele Dalla Bonna... Sidwell isnt thaat bad, its just the fact that (he sucks but not as much as Ben-Haim) he dons the #9 shirt wtfbbq?? As for the latter? come on?? Sam Dalla Bonna? u cant be a soccer player with a name and hairdo like thaat?? (he actually started out pretty fine i guess, but didnt cut it). Cant comment on Bogarde, didnt see him play much (when EPL matches were hard to come by on Astroless TV, what more Chelsea matches)

Randomness

2008-01-29T12:58:00.000-08:00

Random!

U know.. everytime u pick up a lifestyle mag, like Men's Health etc etc..
there will be a section... regarding.. 'Incredible Sex Tips!'
every.. month.. every issue.. will boast new... ways.. to make better lovin..
so really now... how many goddam sex tips are there?1?!?!? :O
or do they just recycle them tips....

Melancholic

2008-01-28T03:05:00.000-08:00

Feelin a lil melancholic?

me too!! hahahha

2008-01-22T15:03:00.000-08:00

Urgh.. tagged by michie.... so.. owh well.. for my first tag o d year.....

The rules are:

Link to the person that tagged you and post the rules on your blog.

Share five random and/or weird facts about yourself on your blog.

Share the five top places on your "want to see or want to see again" list.

Tag a minimum of five random people at the end of your post and include links to their blogs.

Let each person know that they have been tagged by leaving a comment in their blog.

Five random and/or weird facts about myself

1. I... i........ i......... i can.. i take pills and vitamins without water, just saliva and tongue movements to down them.

2. I masturbate with two hands, standing on one leg with an eye closed and my head tilted sideways while fantasizing of.......... you..........

3. My musical repertoire is on par with that of a nutshell.....

4. I dig chicks with names starting with 'J'.

5. Unlike michelle's mum, my mum help teach line dancing........ and i have absolutely no interest in whatever that might be......

Five top places I want to see or see again

I have so many places I want to visit! I can't make up my mind!

1. Cafe Del Mar - Because the place is hot, the ambience is hot, the people are hot, and it makes me hot...

2. New York City - because........... d'oh...

3. Planet Earth, from outer space.

4. The Galapagos - Because its this childhood desire thingy.....

5. Jessica Alba's bedroom - because i want to see her there again *cough*

Geez... this tag's soooooooo short!!! (after like almost half a year ignoring these tags, i was actually lookin forward to answering more)

nevertheless.....

I tag:

Hottie SkySKy

Tashna

Susu

Yoong Kang

:aaaanndd errrrrrrrr Kristine larh!

2008-01-22T12:44:00.000-08:00

I... apologize for the corniness and.... the lacking of enthusiasm in the previous post :S

2008-01-22T02:54:00.000-08:00

WEEEEE!!!!
ok.. im nearly a month late!!
but... neverthelesss... HAPPY NEW YEAR!!!
been busy lately...

a summary? of 2007?? thaats almost too troublesome to do... but i suppose its.. one o thooose troublesome little things that we're obliged todo... well.. regardless...

TWO WORDS to sum 2007 up!!!! GUILTY PLEASURES!!!! as i enjoyed life and partied all the way.. sidetracking from my main course for quite abit... this year musnt be the same...

Lets start... 2007, chronologically... with the 2nd half of my summer vacation in Malaysia. Before i fly back to cold ol melbourne

Tina's 21st @ Cotton Club -> Great party split to two, AusMat bunch and highschool buddies. FREE FLOW ALCHO!! everybody got kinda drunk (me too). Also met Tina's youngest lil sista (or, step sista) cute lil girl....

Then off we go to Pangkor with the 9ners! Aside from a few lil.. unwanted twists, t'was a swell swell trip.

Tashna Darlin's pre-emptive 21st bday (coz her dearest friends are heading to melb before the real date)

Then....... off i flew to melb.. yet again... and melb 2007 started off with, most significantly.. the beginning of my stay/tenure at 123 Drummond Street.. SADLY!! no piccas taken of the place!! and lo, its all joy and fun from then on...........

Clubbin....

And the two roomates i left behind when i hit 123Drummond moved into College Square and became social legends!!!

Darlin Pei Lin's 21st birthday!!!!!!!!!!!!!!!!!!!!!!

Tina's farewell, and her exodus to New Zealand. A new chapter for her, and somehow, a new one for me toooo.

More clubbing

Ru Wen's visit to melb with his buddies, and we went down the Great Ocean road. Enjoyed their company. Cool bunch o peeps from Sydney deprived of good food. They made a return trip few months later almost purely for gastronomical purposes.

SNOWBOARDING! @ FALLS CREEK!! snowboarding is awesome, addictive and count me in again! 2008! everybody whoz not tried it SHOULD!!!

Phillip Island, with Charlotte and her boy, and her bestie Joyce

Daniel koko's errr... 27th birthday @ Copacabana. Lovely place. Great music, great shows.

My 21st, first at Limor's for dinner, then clubbing and drinking (on the day i had EXAMS!) what a horrid horrid decision that turned out to be....

and.. more.. clubbin....

MSA's tanglung festivities

And again.............

Sexpo 2007. Just about the last major thing i did before heading back home. Enjoyable? well, i suppose, but that'll be the only Sexpo i'll ever attend. Arianna Star was blazin hot.

Then back in Malaysia again! for the final quarter of a tumulteous year. And.. its........ more...

Clubbin!!!!!!!

Weee!!!!!!!!

NYAAAAAAAAAA

But not forgetting Meng Tat's 21st...

And Xmas!

2008-01-17T08:59:00.000-08:00

Apparently laaaaa
on firefox browsers..... my new layout..
appears to be fucked up.... (or too narrow)
apologies for the inconvenience and will try fixing it upon return from my singapore trip V(^_^)V

2008-01-15T20:03:00.000-08:00

Off to Singapore!!

Hither we go!!

Hither we go!!

aaand a random picca or two...

Me, Lia, Guna

Chia Ming (top), YenYen, Nadia, Me and Pelin.

Postcard finish

:S

2008-01-03T13:02:00.000-08:00

Perhaps I should close an eye when looking at you.......
for if I use both, then you'd appear too beautiful........

Timeout!! PREEEET!

2008-01-02T07:30:00.000-08:00

why...
why...
whyyyyyyyyyyyy.. the fuckkkkkkk.. am... i... soooooooooooooooo... FUCKINGGGGGGGGGGGG PESSIMISTIC!
ah... hmm.. that made me feel.. a litttle better...

Xmas 2007

2008-01-02T01:48:00.000-08:00

Same old, good old fun! With a few new twists.... and a santa....

Owh and.. the pictures are all... rather big :D got too lazy to resize

Christmas Morning, and the presents

The big kids

The tree

The kid's pile

The adult's pile

The... fragile pile

Introducing... SANTA (Albeit groovy one)

Santa and the kids

Groupshot

Twin terrors

Pei Lin

MEEEEE

I saw mummy kissing saaaanta....

Itsssss wrapper tearing time!!

Tear and Tell

Future playboy at work

Bottomless, and with the ladies..

Christmas Dinner

Table preps

The smiley soup

The Men

The Women

Pei Lin and Kevin

My parents

The Chef and his bird...

The Feast

Dad having a go at carving

Chronicles of Khoo Meng Tat's 21st birthday

2008-01-01T00:52:00.000-08:00

Guys dont normally want tooo elaborate of a party for their birthdays, or just couldnt be fucked doing one, but stil would love a small gathering to commemorate the event, especially if its a significant one, like a 21st. soooo the 9ners held a little gathering at peilin's house (at her gazebo, the official 9ner's lounge muahaha) for him.

Why?

Because, the first attempt to celebrate it in a club was disastrous. Not only did most of the gang failed turn up, the venue was absofuckinglutely crap. (Telawi Somthing Bar? at bangsar). Though, t'was meng tat who insisted on going out for alcho drinks.

The second attempt to 'celebrate' it was at a cyber cafe (we now figured that meng tat enjoys two activities, gaming, and another). Gaming went wrong as well. FTZ Asia Cafe was raided by MPSJ while we're gaming, and meng tat arrived after the raid! Winston's picca was taken by the officers and we jested that his picture will be all over berita harian the next day (because he sat isolated from all of us, and was alone when the picture was snapped). We wanted to head to the next cyber cafe, but that was veto'd off by winston, who said, if MPSJ raided that other place, and his picture be taken again, it'll be double the shame! (think: Gejala 'Kafe Siber' Perosak Remaja Negara, with two different raided cafe's both with his face in it). So we drove a little further away, then found this other cybercafe, with its shutters half open. Since we went all the way out that night for gaming, we might as well try. Winston went down to scout the cafe for its availability. Not before long, wiwi ran back to the car and said : 'drive drive!! macam druggie den bodo! the cafe tables we're monitorless yet people are all in there smoking something foul! what if MPSJ raids this drug place? my picture taken again???' (thinks: Ketagihan Kafe Siber dan Dadah Perosak Wawasan, with winstons picture both in a cyber and a drug den). We decided to call it a day then, t'was running late, and we had absolutely nowhere to go. Meng tat said something about drinking but... the thought of going to buy cheap alchohol from a place we know just made winston think about him getting caught by MPSJ buying alchohol (think: well.. u know the drill 'Hancurlah Remaja kini dengan Tabiat Alkohol, Dadah dan Game Komputer') He'll be the nation's model young citizen!

Finally, when the real day arrives, we asked him 'eh, sooo watcha wanan do fer ur bday?' and he replied 'drink!'. (The 9ners were shocked because.. meng tat isnt normally known to like drinking, or... well we're not exposed to that side of him.. yet) So we just gathered around, bought some drinks, cakes and started. By the first hour, Meng Tat dissapeared to the toilet, then spent the entire night hugging the toiletbowl, half asleep, pale as can be. HAHAHAHAHAHA. He had tooo many shots in a short short amount of time and... hahaha.. got knocked out.

Enjoy the piccas!

Me and Tashna @ TSB

Matta and Meng Tat

Meng Tat and Pei Lin

Bored? anybody??

Meng Tat and the guys

Teh Girls

Me and Munraj

Arsy

Pei Lin and Firman

Mattasan

Pick yer Pois'n Matey... arrrr

Meng Tat, going on strong (his last appearance for the lens before going MIA)

Party has to go on!! with or without the main man!

Main man found!

*pic removed by request from Pei Lin*

Red... as hell...

Note!

2008-01-01T00:26:00.000-08:00

Before i post multiple entries with lotsa piccas...
do note that... my bigass luggage bag broke down in melbourne so i had to make do with Yuhan's slingbag, which, isnt big at all THUS i have... a limited wardrobe selection.. hahaha so most of the stuff i wear will appear again and again and again!!!

The return!

2008-01-01T00:16:00.000-08:00

Owh finally... some peace... and quiet... and time to sit down..
and blog...
before it slips my mind! HAPPY NEW YEAR!!
and of course.. Merry Christmas...
Its been great back home in malaysia again. the malaysianess finally sunk in.
Been busy i guess, with life.. friends... family... the stuff i get todo only during these times of the year.

- Basketballing, in Puchong, with the 9ners. My my, im old! i felt like i've lost another half-a-step!! any slower and i might as well just stand still!!!

- Basketballing, in Kemuning, with my brother and sister. They've both grown tall...

- Chilling out, at pei lin's place, with the 9ners.

- Gaming in cyber cafe's, till early morning, with random loosers groups =P (We call this 'looser activity')

- Shisha at Fendi's stall. Fendi makes gooooooooooood shishaaaa. Hmm perhaps i'll properly document his bizness here on my blog.

- Shopping.

- Driving!!! woooooo

- Eating out wif family or friends.

- Clubbing, but clubs hither pale in comparison with melbourne's finest.

i...........

2007-12-08T13:48:00.000-08:00

i... cant believe i spent 3 hours playing guiter heroes with my buds.............

i..... know i havent been updating this place in some time... consider this my.. sabattical of sorts...

i......... promise updates in a few days time!! gathering the 'media' needed!!!

Updates

2007-12-01T18:31:00.000-08:00

UPDATED!

tra la la la laaa

2007-11-22T10:16:00.000-08:00

Hating the humidity!!
been showering 5 times a day!!!
and here are more quick updates!!!

firstly!!!
last nights' Euro Quals game between England and Croatia was.... footballing entertainment at its best!!!! like wooooooo!! what a match!!! the drama!!! the anxiety!!! and of course England playing with their backs against a burning wall..... I started out backing the Croats, and they scored with amazing ease!!!! 2-0 by halftime!!! but the sheer desire and constant probing, attacking football of the english team was admirable!! so much so that.. i somehow clenched my fist when they scored their first and second goals!! almost sympathetic to their cause.... however, they lost 3-2 at the end.. and... soo.. THANKYU COMEAGAIN!!!

Match Notes:

- Englands defence without Terry and Ferdinand is absolute rubbish!!! the croatian attack waltzed in and out of the english box waaay tooo easy!!! Alienhead and Slow Campbell just isnt up to it (although i think Alienhead is a pretty good player in general)

- Steven Gerrard played magnificently for about 80% of the game. He was everywhere!! getting back to tackle, stringing passes. Awesome stuff. It shows how much he's willing to battle for his country.

- Frank Lampard's penalty was something worth of note. It was Englands chance to pull a goal back when the penalty was awarded and.. i was already praying it wouldnt be Lamps. Im a Chelsea fan, and the pressure to score from the spot was immense.. just immense!! especially with all the criticism surrounding Lamp's England squad spot... A miss would kill lampard.... but no.. he walked up to take the penalty, and took it with a big brave heart... kudos to Lamps. (i was praying Beckham would take it! muahhahah)

- David Beckham was majestic. Old as he is, and back from injury, he still played pretty well, showing his intelligence. His cross that led to the 2nd goal was top class.

- Joe Cole was probably Englands most industrious player on the offensive end.

- Niko Kranjcar played well for Croatia, and somehow when the ball comes to him, it always seems like a dangerous play.

- Urgh i dont really know the names (or at least to spell them out) of the rest of the Croatian squad but they played really well! they dug deep and defended well, then hit England with counterattacks that sliced up the English defence like hot knife tru butter.

Secondly!!
urgh.. when did the HIGHWAY SPEEED LIMITS get capped at 80KPH??
WTF??? thats dammmm slowwwwwwwww.... and Ken Han reports that road blocks and speed traps are occuring more then ever!!! that sux!!1 big time!!!
Does that mean i wont be able to hit gear5 on highways???
like.. cruising at gear4 lalalalala. How pathetic...

Thirdly!!
I consider myself to be a rather easygoing guy...... i think im rather calm and cool, almost rarely agitated and never really too easily angered but.... i now realise.... the one thing that ticks me off ... actually.. wont blog about this laaah.. hahaha

What else?
Meh i just had another evening basketball + night futsal action. Wah penat la. But actually i think my bod's coping with it and im feeling great!

Anything more??
OOWWWWH!!! ive been wanting to mention this for some time now!! i just kept procrastinating but... i.. ith blocked from betahebat.blogspot.com!!! OII YKKKKKKKK ... invite laaa

WHOOOAAH!!!

2007-11-19T08:57:00.000-08:00

Meh... ive been back for.. just over 24 hours..
and...
ive played basketball on 2 occasions..
and 5on5 soccer once....
sooo tired nowww.. 4hours of basketball, shower, dinner then soccer till midnight!!
sigh im gonna have to like 'rest' now.. im no longer young :D
mebbe grab a book or two....
any.... suggestions???

Come Fly with Me

2007-11-17T10:22:00.000-08:00

Bags be stuffed!! filled to the brim!!!
As sheets are folded and tucked away!!!
Ticket in hand, passport in my pants!!
Northward bound i am!!

Shirtsss! check!
Pantssss! check!
Fuck i forgot some underwear!!
Sockss!! check!
Shoess! check!
b'wait, how many pairs to bring?!

Friends await me back at home
Friends i'll leave as i head home
Crossing the sea im gonna be
And eight's the hours that i must see
so how?
come fly with me!

aihz!!!
sooo melancholic.. hahahaha...
cant wait to be back home!!!
yet i loath the smell of malaysia's sweet, humid air...
for everytime i do so... i know.. i've gotten older....
a year will have passed.... as i edge ever closer to complete adulthood...
(some would argue that, at 21, im already a full grown adult!, but really now.. :P )
Come ye Two-Thousand-and-Eight, i greet thee now with a heavy heart!
Come ye now my 22nd year! what hast thou in store for me!

Anyhow... its 6am!!! about 9hours more till my feet leaves the cold, hard soil of Melbourne... and about 17hours till i hit 'tanah airku'...
And im sooo not prepared to be home!!
in fact!! i've never been this unprepared!!! never been this relunctant!!

\(^_^)/

2007-11-15T22:43:00.000-08:00

This girl.. be so hawt!!!
like.. lil underaged but... WHOAH!!!!

The Need to Know!

2007-11-14T08:55:00.000-08:00

Somehow ive been hearing some disturbing news regarding Malaysia and KL for the past few weeks, whats been going on man? ok so i've been ignorant and oblivious to the happenings back home sooo will those in the know shed some light on.... some things that i should know??? since im heading back home very very soooon!!!

NBA 2007-2008

2007-11-12T04:53:00.000-08:00

WOOHOOO!!! it has begun!!!
The 2007-2008 NBA season!! and.. it has never gotten me more excited before!!
Why?? here are a few reasons why:

FIRSTLY!! Boston Celtics made the biggest pre-season trade ever!! bigger even (at least in my eyes) then Shaquille O'Neals' move to Miami. Boston were the biggest loosers last season, having lost more games then any other team that year. The main reason? Paul Pierce, their heart and soul, was sidelined by injuries for long periods of time, leaving a very young and inexperienced Celtics cold and lost. Pierce has been keeping the Celtics from falling apart for a very very long time now, shouldering the burden of winning (or loosing) night in night out. He is, no doubt, is one of the better Guard/Forwards in the league today, just behind the big shadows of Kobe, T-Mac and LeBron. Even so, Pierce cant possibly do it by himself.... tried, failed tried again, and his will wavering.

How now??? Danny Ainge used his little green jedi mind tricks to pull a few strings and traded their bright young players for Kevin Garnett and Ray Allen!! now, the Celtics boast a trio of all-star players! superstars in their own right! and IMHO the most talented trio any team has ever put together in a very... very.. long time....

The Big Green Trio

Ray Allen came from Seattle, where he was the focal point of his team's offence, and like Pierce, shouldering the burden of his team's fortunes night in night out. Ray has, no doubt, one of the best shooting strokes the NBA has ever seen. To imagine Ray teamed alongside a guy like Pierce is breathtaking indeed! A slick, smooth sharpshooter that allen is... and the strong and fast, all rounded game that Pierce brings. Ray's presence outside the 3zone will allow Pierce more freedom to drive into the lanes.

And thats not all!!

KG and his number!

Kevin Garnett is in town!!! saving the best for last, KG is arguably one of the best players in the game today. His basketball repertoire is whole and complete!! KG is a monster in every facet of the game, and he tends to make every1 around him better! The last time he had teamates of considerable 'talent' in Sam Cassell and Latrell Sprewell, they reached the conference finals! Sam Cassell was a crybaby, and Sprewell is equally as bad, but with their 'talents', it was enough to support big KG almost all the way. Sam and Spree are, sadly, NOWHERE CLOSE to the talents and abilities of Pierce and Ray.

Now, how does one stop these 3? Pierce can be quite the force with his penetrations into the lane and his shooting has to be respected as well. Garnett will kill anyone but the best defenders in the league. His moves, speed and scoring touch is excellent. Also is his unselfishness as a team player and his ability to pass the ball, especially when double-teamed. Ray himself commands the respect of any defence becase of his shooting ability. Being in seattle, defences constantly close him down tightly. With Pierce and Garnett around, the defence can no longer shut out just one player, because anyone of them would blow any team apart.

And these 3, never won a Championship, and.. yes, they're very very hungry....

What else?

well, not as exciting as the Boston Celtics is the Milwaukee Bucks.
Nothing big in perticular, just the intrigue of watching rookie Yi JianLian in the NBA. YES! another 7 foot tall chinese player!!! Another Yao Ming>???
well not exactly... Yao is 7 foot 6 inches tall, big big center. Slow, BIG, strong and plays effectively when near (and facing away from) the basket. Yi however, is rather different! 6 inches shorter, still very very tall, but this young kid is extremely athletic. He's far faster then Yao, plays better facing the basket and shoots from long range. In fact, his most notable trait (aside from being 7foot tall, chinese, and much faster then yao ming) is his sweet shooting form, which is, quoting Charlie Rosen, almost flawless. He is however, a tad too skinny, but with a few years building up, he'll be a very very good player indeed. Because really now, how does one stop a 7foot shooter whoz probably quicker then any equally tall defender u put against him.

Anything more?

yea, of course! this is the year Shaq passes down the heavyweight belt to Yao, because, this is the year Yao surpasses Shaq as NBA's BEST CENTER. In fact, Yao already has.... waaaayyy surpassed Shaq's current level of performance. Yao was making his stand for it last year, but with Shaq winning a Championship the year before that, Shaq somehow keeps his #1 spot, for mostly honorary reasons. This year, this year is a no-contest. Yao wins. And because of this, and the resurgence of Tracy Mcgrady, and the fact that Houston Rockets made a couple of nice additions to their squad, would make the Rockets a pretty solid team.

Last but not least, Seattle Supersonics! letting Ray Allen go hurts them offensively, but their willingness to part with the future hall of fame player was in no small part, credited to the drafting of Kevin Durant. Skinny lil kid out of college, Durant is extremely gifted with the basketball, and his scoring and shooting touch is by far the best the NBA has seen from any rookie for the past few years! Look for him to score a bunch this year.

Post-Exam Hiatus???

2007-11-07T07:29:00.000-08:00

Wahahaha...
exams are over!!! and.. well.. i dunno.. i've just been doing things
busying myself about with nothing at all!!!
regardless.. i almost forgot i had a blog :P
time for some 'meaningful' updates!!

First Paper!! : BioChemistry!!
URgh, it was a walk in the park?? everyone came outta the exam hall complaining the paper was hard as hell but.. i .. found it rather easy actually.. mebbe coz regardless of the fact i hate chem, my chemistry repertoire is better then the average biotech students due to my.. past 'experiences'

Second Paper!! : Food MicroBiology!!
urgh.. this one i struggled.. too much to study.. too little time!! and everyone else came outta the hall telling me 'twas an easy paper!! what the hell!! im sooooo dead!! worried.. pray theres supplementaries...

Third Paper! : Advanced Bioinformatics
Geez.. had to travel all the farking way to bundoora for this.. and it was a sitter this... im pretty sure i'll pass..... (unless my assignments got ditched rreaaall bad)

Post-Exam activities!!!!
NONE!! jebus!!!
right after exams! i spent the entire night watching anime on bed... in a very very very bad position which might have hurt my back somehow..
because.. the next day! during futsal, after what i would consider an ordinary fall, i hurt my back realll bad.. in fact.. its hurting now!!
mann.. ive had a history of back injuries.. and.... what a time for it to re-occur!! RIGHT as im about to head back home to malaysia!! DAMMIT!!
WHATABOUT BASKETBALLL!!! NOESSSSSSSSSSSS

Other exciting happenings so far would be like
- Aris starting to date a girl...
- This game Football Manager 2008 is out!! i got it.. and its taking over my life....
- Chelsea back on song (for now)...
- NBA season starts!! owhhh!! NBA restart needs a dedicated post!! sooo excitingggg!!!

BEfore im off ... hither are some paparchase humour....

urgh wargh.. something wrong with blogger.com's image uploads!1 dammit!
just when i wanted 2 post an entry!!!

Happy Birthday to mee!! V(^_^)V

2007-10-21T09:44:00.000-07:00

Part 1 : Friday night @ VII

wootnesss...
okok so it isnt reaaally my birthday yet but... due to exams n such..
decided to 'celebrate' it over the weekend!!!
and since Tar's and Ric's birthdays are around the same time (in Ric's case, we share the same birthday) every1 decided to just bring em all out and smash em wif alchohol at 7... So... there isnt really anything to blog about....
went there, early, boring, drank drank drank..
drank some more... saw eugene and mun hoong ... said hie.. tagged along with them to escape the drinks.. more friends came in.. crowd started pouring... bottles getting emptied..
basically table hopped around drinking and all but somehow..
managed to stay sober enough ..
some few people however.. got quite quite drunk :D ahahha..
actually... i got pretty drunk as well i think....
if memory serves... i came home in a cab, bounced from wall to wall to my room, took off my shirt... and... started playing DoTA...... till daybreak...
roflol................

From Left: Junie, Harjunan, Myself, Pras, Ollie and Ivan

Meet the Drummond Boys!! (or rather... just 75% of us) Yuhan and Aris

When alchohol takes over.....

Me, Goku? and Tinesh?

The other table! with clockwise from far left: Yuhan, Jon, Derry, Ric(bday boy) and Tak

The other birthday boy Tar (center), with Arthur, Benson and.. some.. urgh peoples...

Part 2: The Feast @ Limors

Ah, Saturday night.. after a hectic friday, we decided to tone down and have some good food @ Limors, a well known greek eat. THIS TIME AROUND!!! My Dearest Cousin agreed to turn up!! (SHE SNUBBED FRIDAY NIGHT AT CLUB 7!!) So did Daniel and Nic. Decent dinner, food was... well.. meaty :D to say the least. Now!! here comes the SAD PART!!!... every1 was looking to get me pissed drunk on Friday night!!.. they failed!!.. i paced myself nicely with the drinks but... at limors... Daniel bought me a Flaming Lamborgh just before we started eating ... and... just one glass.. and.. i.. puked.... right after dinner....
holy crap.... but well.. i blame that on my empty stomach (havent had a meal the entire day till dinner. But still great dinner!! (although it all came out right after) I suppose the puking was retribution for tthe fact i did not puke in the club? ahhahah

The Drummond Boys (minus Justin, add Treshan) in front of our house

Seafood Platter (yes, each platter includes 2 men)

The meat platter

The guys

The girls

The cheap drunk....

Last but not least!!! a shoutout to my dear friends whoz birthdays also fall somewhere near mine!! Ken Han, Joyce, Suey, Amanda (same bdate), Jocelyn(same bdate) and urgh.. cant remember.. got more la..

Loading and Saving..

2007-10-16T00:17:00.000-07:00

Aih...
why cant we 'save' and 'reload' life???
like in PC games V(^_^)V
wouldnt that be soooo convenient? :D
actually at this moment in time.. i feel.. its more like... i saved, at a good time..
then continued to see what the outcome would be, and the outcome proved to be fine just as it is
and so i continued on... and on... and then it suddenly hits me that in the long run, this is'nt going tooo well, and it all started from that point in time!! bbbbut!!!
DAYUM!!! i've overwritten the save slot!!!!
OMGWTFBBQ!!!
so... i suppose.. life goes on.... albeit certain misfortunes..... we'll see whats in store next! :D
and this time on.. im gonna save.. more often :D and using different slots too!!
hahahahaha

why no updates???

2007-10-15T09:56:00.000-07:00

well..

Sequence used: #28 (Nucleotide Seq.)
Sequence used: #28
agtatttctctcgcgagaaaccgctgcgcggacgatacttgaagaggtggggaaaggagggggctgc
gggagccgcggcagagactgtgggtgccacaagcggacaggagccacagctgggacagctgcgagc
ggagccgagcagtggctgtagcggccacgactgggagcagccgccgccgcctcctcgggagtcggag
ccgccgcttctccactggcaggggccgcctgaagtgggagcagcgcctggagaaggcgggaggagcc
cggcccgggggacgggcggcgggatagcgggaccccggcggcgcggtgcgcttcagggcgcagcgg
cggccgcagaccgagccccgggcgcggcaagaggcggcgggagccggtggcggctcggcatcatgc
gtcgagggcgtctgctggagatcgccctgggatttaccgtgcttttagcgtcctacacgagccatgggg
cggacgccaatttggaggctgggaacgtgaaggaaaccagagccagtcgggccaagagaagaggcg
gtggaggacacgacgcgcttaaaggacccaatgtctgtggatcacgttataatgcttactgttgccctg
gatggaaaaccttacctggcggaaatcagtgtattgtccccatttgccggcattcctgtggggatggat
tttgttcgaggccaaatatgtgcacttgcccatctggtcagatagctccttcctgtggctccagatccata
caacactgcaatattcgctgtatgaatggaggtagctgcagtgacgatcactgtctatgccagaaagga
tacatagggactcactgtggacaacctgtttgtgaaagtggctgtctcaatggaggaaggtgtgtggcc
ccaaatcgatgtgcatgcacttacggatttactggaccccagtgtgaaagagattacaggacaggccc
atgttttactgtgatcagcaaccagatgtgccagggacaactcagcgggattgtctgcacaaaaacgc
tctgctgtgccacagtcggccgagcctggggccacccctgtgagatgtgtcctgcccagcctcacccctg
ccgccgtggcttcattccaaatatccgcacgggagcttgtcaagatgtggatgaatgccaggccatccc
cgggctctgtcagggaggaaattgcattaatactgttgggtcttttgagtgcaaatgccctgctggacac
aaacttaatgaagtgtcacaaaaatgtgaagatattgatgaatgcagcaccattcctggaatctgtgaa
gggggtgaatgtacaaacacagtcagcagttacttttgcaaatgtccccctggtttttacacctctccag
atggtaccagatgcatagatgttcgcccaggatactgttacacagctctgacaaacgggcgctgctcta
accagctgccacagtccataaccaaaatgcagtgctgctgtgatgccggccgatgctggtctccagggg
tcactgtcgcccctgagatgtgtcccatcagagcaaccgaggatttcaacaagctgtgctctgttcctat
ggtaattcctgggagaccagaatatcctcccccaccccttggccccattcctccagttctccctgttcctc
ctggctttcctcctggacctcaaattccggtccctcgaccaccagtggaatatctgtatccatctcgggag
ccaccaagggtgctgccagtaaacgttactgattactgccagttggtccgctatctctgtcaaaatggac
gctgcattccaactcctgggagttaccggtgtgagtgcaacaaagggttccagctggacctccgtgggg
agtgtattgatgttgatgaatgtgagaaaaacccctgtgctggtggtgagtgtattaacaaccagggtt
cgtacacctgtcagtgccgagctggatatcagagcacactcacgcggacagaatgccgagacattgat
gagtgtttacagaatggccggatctgcaataatggacgctgcatcaacacagatggcagttttcattgc
gtgtgtaatgcgggctttcatgttacacgagatgggaagaactgtgaagatatggatgaatgcagcat
aaggaacatgtgccttaatggaatgtgtatcaatgaagatggcagttttaaatgtatttgcaaacctgg
attccagctggcatcagatggacgttattgcaaagacattaacgagtgtgaaacccctgggatctgca
tgaacgggcgttgcgtcaacactgatggctcctacagatgtgaatgcttccctggactggctgtgggtc
tggatggccgtgtgtgtgttgacacacacatgcggagcacatgctatggtggatacaagagaggccag
tgtatcaaacctttgtttggtgctgtcactaaatctgaatgctgttgcgccagcactgagtatgcatttg
gggaaccttgccagccgtgtcctgcacagaattcagcggaatatcaggcactctgcagcagtgggcca
ggaatgacgtcagcaggcagtgatataaatgaatgtgcactagatcctgatatttgcccaaatggaat
ctgtgaaaaccttcgtgggacctataaatgtatatgcaattcaggatatgaagtggattcaactgggaa
aaactgcgttgatattaatgaatgtgtactgaacagtctcctttgtgacaatggacaatgtagaaatact
cctggaagttttgtctgtacctgccccaagggatttatctacaaacctgatctaaaaacatgtgaagaca
ttgatgaatgcgaatcaagtccttgcattaatggagtctgcaagaacagcccaggctcttttatttgtg
aatgttcttctgaaagtactttggatccaacaaaaaccatctgcatagaaaccatcaagggcacttgct
ggcagactgtcattgatgggcgatgtgagatcaacatcaatggagccaccttaaagtcccagtgctgc
tcctccctcggtgctgcgtggggaagcccgtgcaccctatgccaagttgatcccatatgtggtaaaggg
tactcaagaattaaaggaacacaatgtgaagatatagatgaatgtgaagtgttcccaggagtgtgta
aaaatggcctgtgtgttaacactagggggtcattcaagtgtcagtgtcccagtggaatgactttggatg
ccacaggaaggatctgtcttgatatccgcctggaaacctgcttcctgaggtacgaggacgaggagtgc
accctgcctattgctggccgccaccgcatggacgcctgctgctgctccgtcggggcagcctggggtact
gaggaatgcgaggagtgtcccatgagaaatactcctgagtacgaggagctgtgtccgagaggacccg
gatttgccacaaaagaaattacaaatggaaagcctttcttcaaagatatcaatgagtgcaagatgata
cccagcctctgcacccacggcaagtgcagaaacaccattggcagctttaagtgcaggtgtgacagcgg
ctttgctcttgattctgaagaaaggaactgcacagacattgacgaatgccgcatatctcctgacctctg
tggcagaggccagtgtgtgaacacccctggggactttgaatgcaagtgtgacgaaggctatgaaagt
ggattcatgatgatgaagaactgcatggatattgatgagtgtcagagagatcctctcctatgccgagg
tggtgtttgccataacacagagggaagttaccgctgtgaatgcccgcctggccatcagctgtcccccaa
catctccgcgtgtatcgacatcaatgaatgtgagctgagtgcacacctgtgccccaatggccgttgcgt
gaacctcatagggaagtatcagtgtgcctgcaaccctggctaccattcaactcccgataggctattttg
tgttgacattgatgaatgcagcataatgaatggtggttgtgaaaccttctgcacaaactctgaaggca
gctatgaatgtagctgtcagccgggatttgcactaatgcctgaccagagatcatgcaccgacatcgat
gagtgtgaagataatcccaatatctgtgatggtggtcagtgcacaaatatccctggagagtacaggtg
cttgtgttatgatggattcatggcatctgaagacatgaagacttgtgtagatgtcaatgagtgtgacct
gaatccaaatatctgcctaagtgggacctgtgaaaacacgaaaggctcatttatctgccactgtgata
tgggctactccggcaaaaaaggaaaaactggctgtacagacatcaatgaatgtgaaattggagcac
acaactgtggcaaacatgctgtatgtaccaatacagcaggaagcttcaaatgtagctgcagtcccgg
gtggattggagatggcattaagtgcactgatctggacgaatgttccaatggaacccatatgtgcagcc
agcatgcagactgcaagaataccatgggatcttaccgctgtctgtgcaaggaaggatacacaggtga
tggcttcacttgtacagaccttgatgagtgctctgagaacctgaatctctgtggcaatggccagtgcct
caatgcaccaggaggataccgctgtgaatgcgacatgggcttcgtgcccagtgctgacgggaaagcc
tgtgaagatattgatgagtgctcccttccgaacatctgtgtctttggaacttgccacaacctccctggcc
tgttccgctgtgagtgtgagataggctacgaactggacagaagcggcgggaactgcacagatgtgaa
tgaatgcctggatccaaccacgtgcatcagtgggaactgtgtcaacactccaggcagctatatctgtg
actgcccacctgattttgaactgaacccaactcgagttggctgtgttgatacccgctctggaaattgct
atttggatattcgacctcgaggagacaatggagatacagcctgcagcaatgaaattggagttggtgtt
tccaaagcttcctgctgctgttctctgggtaaagcctggggtactccttgtgagatgtgtcctgctgtga
acacatccgagtacaaaattctttgtcctggaggggaaggtttccgaccaaatcctatcaccgttatat
tggaagatattgatgagtgccaggagctaccagggctgtgccaaggaggaaaatgtatcaacacctt
tgggagtttccagtgccgctgtccaaccggctactacctgaatgaagatacacgagtgtgtgatgatg
tgaatgaatgtgagactcctggaatctgtggtccagggacatgttacaacaccgttggcaactacacc
tgtatctgtcctccagactacatgcaagtgaatgggggaaataattgcatggatatgagaagaagttt
gtgctacagaaactactatgctgacaaccagacctgtgatggagaattgttattcaacatgaccaaga
agatgtgctgctgttcctacaacattggccgggcgtggaacaagccctgtgaacagtgtcccatccca
agtacagatgagtttgctacactctgtggaagtcaaaggccaggctttgtcatcgacatttataccgg
tttacccgttgatattgatgagtgccgggagatcccaggggtctgtgaaaatggagtgtgtatcaaca
tggttggcagcttccgatgtgaatgtccagtgggattcttctataatgacaagttgttggtttgtgaag
atattgacgagtgtcagaacggcccagtgtgccagcgcaacgccgaatgcatcaacactgcaggca
gctaccgctgtgactgtaagcccggctaccgcttcacctccacaggacagtgcaatgatcgtaatgaa
tgtcaagaaatccccaatatatgcagtcatgggcagtgcattgacacagttggaagcttttattgcct
ttgccacactggttttaaaacaaatgatgaccaaaccatgtgcttggacataaatgaatgtgaaaga
gatgcctgtgggaatggaacttgccggaacacaattggttccttcaactgccgctgcaatcatggttt
catcctttctcacaacaatgactgtatagatgttgatgaatgtgcaagtggaaatgggaatctttgca
gaaatggccaatgcattaatacagtggggtctttccagtgccagtgcaatgaaggctatgaggtgg
ctccagatgggaggacctgtgtggatatcaatgaatgtcttctagaacccagaaaatgtgcaccag
gtacctgtcaaaacttggatgggtcctacagatgcatttgcccacctggatacagtcttcaaaatga
gaagtgtgaagatattgatgagtgtgtcgaagagccagaaatttgtgccctgggcacatgcagtaa
cactgaaggcagcttcaaatgtctgtgtccagaagggttttccttgtcctccagtggaagaaggtgc
caagatttgcgaatgagctactgttatgcgaagtttgaaggaggaaagtgttcatcacccaaatcc
agaaatcactccaagcaggaatgctgctgtgccttgaagggagaaggctggggagacccctgcga
gctctgccccacggaacctgatgaggccttccgccagatatgtccttatggaagtgggatcatcgtg
ggacctgatgattcagcagttgatatggacgaatgcaaagaacccgatgtctgtaaacatggacag
tgcatcaatacagatggttcctatcgctgcgagtgtccctttggttatactctagcagggaatgaatg
tgtagatactgatgaatgttctgttggcaatccttgtggaaatggaacctgcaagaatgtgattgga
ggttttgaatgcacctgcgaggagggatttgagcccggtccaatgatgacatgtgaagatataaat
gaatgtgcccagaatcctctgctctgtgccttccgatgtgtgaacacttatgggtcatatgaatgcaa
atgtcccgtgggatatgtgctcagagaagaccgtaggatgtgcaaagatgaggatgagtgtgaag
agggaaaacatgactgtactgaaaaacaaatggaatgcaagaacctcattggcacatatatgtgc
atctgtggacccgggtatcagcggagacctgatggagaaggctgtgtagatgagaatgaatgtca
gacgaagccagggatctgtgagaatgggcgctgcctcaacacccgtgggagctacacctgtgagtg
taatgatgggtttaccgccagccccaaccaggacgagtgccttgacaatcgggaagggtactgctt
cacagaggtgctacaaaacatgtgtcagatcggctccagcaacaggaaccccgtcaccaaatcgg
aatgctgctgtgacggagggagaggctggggtccccactgtgagatctgccctttccaggggactg
tggctttcaagaaactctgtccccatggccgaggattcatgaccaatggagcagatatcgatgaatg
caaggttattcacgatgtttgccgaaatggggaatgtgtcaatgacagaggatcatatcattgcatt
tgtaaaactgggtacactccagatataactgggacttcctgtgtagatctgaacgagtgcaaccag
gctcccaaaccctgcaattttatctgcaaaaacacagaagggagttaccagtgttcatgcccgaaa
ggctacattctgcaagaggatggaaggagctgcaaagatcttgatgagtgtgcaaccaagcaaca
caactgccagttcctatgtgttaacaccattggcggcttcacatgcaaatgtcctcccggatttaccc
aacaccatacgtcctgcattgataacaatgaatgcacctctgacatcaatctgtgcgggtctaaggg
catttgccagaacactcctggaagcttcacctgtgaatgccagcggggattctcacttgatcagacc
ggctccagctgtgaagacgtggacgagtgtgagggtaaccaccgctgccagcatggctgccagaa
catcattgggggctacaggtgcagctgcccccagggctacctccagcactaccagtggaaccagtg
tgttgatgaaaacgaatgcctcagcgctcacatctgcggaggagcctcctgtcacaacaccctggg
gagctacaagtgcatgtgtcccgccggcttccagtatgaacagttcagtggaggatgccaagacat
caatgaatgtggctctgcgcaggccccctgcagctatggctgttccaataccgagggcggttacctg
tgtggctgtccacctggttacttccgcataggccaagggcactgtgtttctggaatgggcatgggcc
gaggaaacccagagccacctgtcagtggtgaaatggatgacaattcactctccccagaggcttgtt
acgagtgtaagatcaatggctaccccaaacggggcaggaaacggagaagcacaaacgaaactga
tgcctccaatatcgaggatcagtctgagacagaagccaatgtgagtcttgcaagttgggatgttga
gaagacagccatctttgctttcaatatttcccacgtcagtaacaaggttcgaatcctagaactcctt
ccagctcttacaactctgacgaatcacaacagatacttgatcgaatctggaaatgaagatggcttc
tttaaaatcaaccaaaaggaagggatcagctacctccacttcacaaagaagaagccagtggctgg
aacctattcattacaaatcagtagtactccactttataaaaagaaagaacttaaccaactagaaga
caaatatgacaaagactacctcagtggtgaactgggtgataatctgaagatgaaaatccaggttt
tgcttcattaattcaccatccagaaaccaaataattaaaagaaaaacaaatatagataggtagaa
ctatattttcccccaatcagaatcatcatatcataggtacaatctttcaccaagtaaatttgtataa
ataagcactattctttgtattaccaaagcaaggtacaggtgactaccctagttcaaaacaaccact
ttctcaggcttctcatgtgtgtagctaagctaccttgtcatatgtgttgattcttgaaaactgggac
gtgtatttccattgggggttggccatttatgctgacatgccatccttccagcaaacgtaygggaa
tgtgctttcaattgatggactactctattttttgcaaatttgtaaactttgcttctccaaatacaag
tactaggttgtccatttatggtacctatttggtgctagtaaattttcaaactagatttataaatgca
ctgtaatatgtacacaacttagaaaccaaattacaagtattcagttccaatacttcattaatttca
atcaaccaaagttagttcagtagcttatctcagttatgagtataatacattacatgtaaattaagt
gtgtgtatactgtaatcgtgctattttttatcattgaaacatttataaactagaataataatgccct
taatgtgagggtttgtaatggtgcttattaagaccaaagacttgttaaatgtatacaccaagtgg
taatgaaatttckgtgactggcccacacgtgcatagaggtctgggaggaccaggaaacagcctc
agtggccagaggatcaccagtgcatccttcatcacagcatgtgcaatatgccaagattaccctcg
gtcattcctgtcaacaaggggtcaatgtcataaatgtcacaataaaacaatctcttcttttttttagtttaaaaaaaaaaaaa

Project Green Tea

2007-10-12T11:34:00.000-07:00

Commencing project green tea... :D
will be having herbal green tea from today.. till next friday..
just to .. cleanse my body n prepare for armaggedon ...

The Kingdom

2007-10-07T21:27:00.000-07:00

One of the better movies.. or.. actually, the best movie out of this year's lineup. Tis a post-9/11 film about FBI agents and their dealings in the middle east. Though at times, the movie can be rather leaning towards the pro-USA side, with cheap propaganda shots (like the ones found on documentaries) targeting the audiences, i must admit, these cheapshots are well placed. Storyline was refreshing (a little controversial IMHO lah), compared to the rest of the 'big hits' of the year like Transformers, Bourne Ultimatum or Spiderman 3. Highly recommended watch!!

Green is in

2007-10-04T11:40:00.000-07:00

Green is what i found, hidden somewhere around.
Green is what i need, now then, i can feed.
Green that i just found, i knew was around.
Green that was around, i kept safe and sound.
Green that was kept, was hidden somewhere tact.
Green that was hidden, forsaken and forbidden.
Green now i have, yet loath i am to use.
Green that was taboo, shall now i put to good use.

Hide N Seek

2007-10-02T09:22:00.000-07:00

Some interesting reads from others.....

Manifest 2007 @ Ronnie's blog

I missed this bigass anime festival in melb, but ronnie, being the otaku he is, was present and hither are his reports for that weekend!

Day 1

Day 2

Wilson!! @ Joyce's blog

HOOO!!! i actually got an entire post dedicated to me!! ahahaha

OMG.... Wilson!!!

Boy on a stick and Slither

Humour ... not for the airheaded ones...

Nerdy Pick Up lines @ Hanie's

33reasons.com

referred by yoongkang, tis 33 reaons why thou shalt naught post your picture up on the internet hahahaha (how contradictory to most of us bloggers)

I Dissapear

2007-10-01T07:41:00.003-07:00

Will not be blogging too frequently for the moment..
'life' caught up wif me... and 'studies' ran ahead of me...

'Make them cry' I told her...

Dreams....

2007-09-27T10:27:00.000-07:00

Ive been dreaming about her in my sleep lately...
if im not mistaken... this be the fourth night in just over a week...
i... wonder..............
what.. is going on...

Only Thee

2007-09-23T23:52:00.001-07:00

That I want thee, only thee –
let my heart repeat without end.
All desires that distract me, day and night,
are false and empty to the core.

As the night keeps hidden its gloom
the petition for light, even thus in the depth
of my unconsciousness rings the cry –
I want thee, only thee.

As the storm still seeks its end in peace
when it strikes against peace with all its might,
even thus my rebellion strike against thy love
and still its cry is – I want thee, only thee.

- Rabindranath Tagore -

Jose Mourinho 2004-2007

2007-09-19T22:49:00.000-07:00

- "Please don't call me arrogant, but I'm European champion and I think I'm a special one."

- "We have top players and, sorry if I'm arrogant, we have a top manager."

- "If I wanted to have an easy job...I would have stayed at Porto - beautiful blue chair, the UEFA Champions League trophy, God, and after God, me."

- "Pressure? What pressure? Pressure is poor people in the world trying to feed their families. Working from dawn till dust just to feed their young. There is no pressure in football"

- "Look, we're not entertaining? I don't care; we win."

- "Everybody wants Chelsea to lose a game. When they do they should declare a public holiday."

- "I saw their players and manager go for a lap of honour after losing to us in their last home game. In Portugal if you do this, they throw bottles at you." - on Manchester United

- "I think he is one of these people who is a voyeur. He likes to watch other people. There are some guys who, when they are at home, have a big telescope to see what happens in other families. He speaks, speaks, speaks about Chelsea." - on Arsène Wenger

- "Young players are a little bit like melons. Only when you open and taste the melon are you 100 percent sure that the melon is good.Sometimes you have beautiful melons but they don't taste very good and some other melons are a bit ugly and when you open them, the taste is fantastic." - Mourinho's melon metaphor on young players, 9 Jun 2007

Omelette, eggs. No eggs, no omelettes. It depends on the quality of the eggs. In the supermarket you have eggs, class one, class two, class three. Some are more expensive than others, and some give you better omelettes. When the class one eggs are in Waitrose and you cannot go there, you have a problem. - Mourinho on his Chelsea squad the day he parted company with the team, 17 September 2007

Got Milk?

2007-09-18T04:04:00.000-07:00

Woke up this morning.. (afternoon)
went to make my standard cold soba noodles for brunch... and theres this note written on the fridge.. from the level of english on it, i can only expect it to be from Jien, the chinese international student living in our house.

so im like.. hurh?? milk?? lotsa milk? but how much did she buyla? the mega 5 litre ones??

...
..
.

Opened the fridge... rubbed my teary morning eyes and.......

.
..
...

whoah....
wtf??? did she rob a milk factory???
Justin: mebbe she saved a farmers life??
Me: ah.. who cares... free milk... :D
time to finish off all the chocolate powder i inherited from Tashna, Tanu and Amrita ..

But its Mrs. Fields dammit...

2007-09-15T20:12:00.000-07:00

Sunday

woooo.. fourty two dorra sunday breakfast!! V(^_^)V
expensive.. but urgh.. maybe just about worth the price.. :D
had dim sum (yumcha) at shark fin inn ... woooo went wild with the orders...
blew 30bux there.. then on the way back i stopped to buy some choc chip cookies from Mrs. Fields...

Yuhan: WTF? cookies??? are u not stuffed???
Arisie: yeah man.. the thought of handling food makes me feel like throwing up
WilZC: but its mrs fields dammmit.. mrs. fields!!!
Yuhan: 12bux worth of cookies.. omg... that costs as much as the clothes hanger aris bought
WilZC: But its Mrs. Fields dammit.... its worth more then the hanger!
Yuhan: Nooooo? the hanger can be used over n over again, thoose cookies are perishables....
WilZC: what bullshit... every mrs. fields choc chip u eat becomes a part of your soul V(^_^)V (holds the bag of cookies against my chest)
Yuhan: ..................
Arisie: Fuck.. wheres the car man? fucking hanger is fucking heavyla....
WilZC: takes a bite of the Chewy Choc Fudge Cookie (actually feeling rather really fucking full)

Saturday

Hmm.. another soccer saturday....
played hell lotsa soccer.. THEN watched alot of EPL matches.. and.. mann..
another fucking dissapointing Chelsea performance...
sien.....

Liverpool vs Portsmouth 0-0 fucking boring game.. couldnt take it.. fell asleep on Arisie's bed... (i think my head was on his boxers -_-')

Wooo...

2007-09-13T11:26:00.000-07:00

havent been blogging in awhile now eh? muhahaha.. been really busy.. with... football manager!!! according to the game.. my addictednes rating is -> time to change your underwear!!

that.. and assignments... omg.. i had a 27 page assignment!!! jebus !!!
i thought i'd breeze tru it because the previous assignment given by the lecturer was completed by me in half n hour but no!! this one took 8hours!! from 2am till 7am in the morning, then realized i cant finish it completely without proper references so i rushed to the library and finished it off.. came home at 10-ish in the morning.. almost dead....

i'll place a few excerpts jsut for the record :D
i was messing around wif the answers because it was 6am in the mornign and i really cbf doing it... because the library isnt open and im stuck...

whats worse... after handing in the assingment at 10, while walking back... i.. kinda rememebered.. or rather i think i kinda forgot to revert some of the messed up answers.. like the saggy tits one.. :S owh man.. and my lecturer DOES have kinda saggy titties... lalalla

EGGS
----------------------------------------------------------------------------------
- Spoilage of eggs by bacteria is commonly known as : NinjaEggs

This refers to : eggs that have mastered ninjutsu, thus appearing black in colour and may produce foul odour when aggravated.

- Spoilage of eggs by mould is often known as : err.. NinjaEggs2 (Shippuden)

This is named because examination by candling reveals shurikens in the egg that look like pin heads.

MILK
----------------------------------------------------------------------------------

Causes of mastitis include :

· Staphylococcus sp. ( Aureus)

· Escherichia coli

· Streptococcus sp. (Alpha and Beta strains)

· Excessive sucking of tits

MAINTENANCE OF MILKING EQUIPMENT

* The most important source of spoilage flora in raw milk

* All equipment requires sterilization (brush your teeth before u suck)

* If poorly maintained, may cause:

· Infected teat cup liners

· Infected vacuum pump spreading infection.

· Contaminated milk

· Saggy tits

CHICKEN
----------------------------------------------------------------------------------

SOURCE OF BACTERIAL CONTAMINATION IN CHICKEN

- Pseudomonas sp.

- Flavobacterium sp.

- Ninjas

Organoleptic indications of spoilage

` Urgh.. organo wadafak?? somebody google this fer me

` -----------------------

` -----------------------

SEAFOOD
----------------------------------------------------------------------------------

SOME MEASURES TO REDUCE CONTAMINATION OF SEAFOOD

- Storage at freezing temperatures

- Refrain from taking a piss while ur skinny dipping in the sea

PREDOMINANT SPECIES FOUND ON SEAFOOD
Gram-negative bacilli such as:

· E.coli

· Salmonella sp.

· Shigella

· Pseudomonas sp.

· Campylobacter

· Wedding Rings

Types of fish and causes of spoilage

· spoilage of most species is primarily due to protein degradation

· fatty fish (up to 25% lipid) undergo liposuction

· molluscs undergo ____________ , rather than proteolytic spoilage

Unpleasant odours due to

· Deamination forming ammonia

· Mebbe i just farted??

2007-09-07T10:06:00.000-07:00

Just got back from Cafe Notturno, and.. the LCD tv's there was just bombarding us with.. some real.. old school stuff (while occasionally playing some modern RnB) soo... here.. have fun!!!

.................

2007-09-02T09:54:00.001-07:00

Chelsea just lost 0-2 to Aston Villa.........
i feel like ripping sum1's head off..... fucking retards.....
for all the fucking money in the world, they cant play football.....
sigh.. sigh sigh sigh.... feel like giving up on them yet again...
i guesss i better go workout lah... do some weights 3am in the morning to.. release off the pent up anger positively... man.. fucking HELL ARGH!!
whats worse? remember me and my housemates playing Football Manager?
well.. yeah my lead on the boys has been minimized to almost NOTHING!! and my team is playing poorly! omg double whammer!!! sienlaAAA

well, enough of the footballing woes. I suppose after my little workout (which should end up getting procrastinated by the time im through with this post), i'll continue watching some anime to lighten up the night. Recently got hooked to Death Note. On the surface, it sounds really... weird.. like WTF some notebook that enables one to kill just by writing names on it. Thats just retarded! But after delving into the plot, its one helluva well thought story. And the characters and their personas are nothing short of amazing. No super powers (cept the deathnote), just... mental jousting, plotting, deductions and clever analysis of events. And.. and.. and .. and L is just soo cool :P ahahaha.

Which comes to the topic of... maybe its just me, and my preference for witty and intelligent characters that are sort of a pacifist by nature, avoiding physical fights if necessary. Because, i am liek that too! Though, i suppose i do have the credentials to actually put up a fight :P Taekwondo for at least 10years of my early life. A little bit of kenjutsu, an introduction to jujitsu and, well, being somewhat gifted in giving massages, knowing and feeling pressure and pleasure points of the human body, i do also know places where i can inflict excruciating pain towards someone (sans the balls of course, thats common knowledge). Now, will there be a chance to try some of these things? hmm.. well if chelsea continue to frustrate me i just might snap...

before i wrap up my rants, i noticed bloggers new 'add video' thingy. Now.. lets try uploading something

ps: Hey there DElilah getting annoying so i removed it, go download the mp3 urself if u like it.

There is no such thing as shark attacks!!

2007-09-01T22:28:00.000-07:00

Quoting Gilbert Arenas from his NBA blog :

I know this is random, but I just want to clear this up for people out there.
There are these things called shark attacks, but there is no such thing as a shark attack. I have never seen a real shark attack.

I know you’re making a weird face as you’re reading this. OK people, a shark attack is not what we see on TV and what people portray it as.

We’re humans. We live on land.

Sharks live in water.

So if you’re swimming in the water and a shark bites you, that’s called trespassing. That is called trespassing. That is not a shark attack.

A shark attack is if you’re chilling at home, sitting on your couch, and a shark comes in and bites you; now that’s a shark attack. Now, if you’re chilling in the water, that is called invasion of space. So I have never heard of a shark attack.

When I see on the news where it’s like, “There have been 10 shark attacks,” I’m like, “Hey, for real?! They’re just running around? Sharks are walking now, huh! We live on the land, we don’t live underwater.”

ps: Gilbert has some funny and reads there, though he might be kinda realllly reallly egoistic but.. still its all good fun.

LUST!!!

2007-08-30T23:32:00.000-07:00

Such a lusty little boy i am...
stumbled upon a menu from a restaurant down at Crown. The Brasserie it be callled. Its .. rather pricey but .. im rather.... dying to have a go at the menu. Why??
TARTUFO of course!!!!.. though its not exactly the ones from Italy (Alba), for now, these ones should do. sooooo any1? be my date for the night???

- Also on my lustlist is a pair of new LBJ basketball shoes but.. that has been settled by the purchase of my new Converse Birdseye! :D loving them kicks!!!

- The shoes, AND a pair of blue-brown toned Levi's jeans :D

Football Manager 2007

2007-08-28T11:50:00.000-07:00

urgh.. been really lazy 2 update...
football manager.. is.. killing me..
talkabout social retardation...

*now.. why wont fucking daniel alves sign for my team goddamit*

The Mud Butt Chronicles

2007-08-25T09:51:00.000-07:00

After our weekly football session today, one of our friends had spicy Szechuan food cravings so we went to this famous eatery to satisfy his needs. Food was great albeit spicey. Sometimes the chilli just overpowers every other taste around till its practically chilli tasted food of different textures (chicken, duck, pork, fish and eggplant). And after an overdose of spices? well.. the DSB rushed home to the toilet.. alll of us!! MUD BUTT!! omg omg omg.. everybody needed to crap badly, and theres only 2 toilets. Aris took fucking half an hour goddamit. My bowel was about to blowwwwww urgh!!! holding back!!!! the shizzzz. But well.. when my turn came, i took my aroma therapy sticks and lit them up in the toilet then did bidznezz. Ya knowww... the release of pent up faeces (or mud in this case) can be quite the sensation. After the aroma sticks were in place, i sat there on the bowl, looked up to the ceiling with my eyes rolled upwards as if tranced, then i.. released..... followed by moans of gratification... of emancipation. The relieved load, the release, almost.. orgasmic.... as i pant and gasp for air, awaiting the second burst, then the third. *HIT ME!! HIT ME AGAIN!! I KNOWW THERES MORE TO IT!* OWH!!! ARGHHHH OOOOOOOOOOOOOOOOOOOOOOORGH yeah.. One final one for the road, then im done, tissues to wipe up, then off to the showers for the afterplay. Toilet bowl looked like it was a venue for some destruction derby or sumtin, had to clean it up ahhahahaha.

Conclusion -> Mud Butt man... i'z dangerez

Bleh....

2007-08-24T12:18:00.000-07:00

Bored.. its 5am.. i ran outta blogs to stalk.. staring blankly at the screen..
i cant sleep... nor do i feel the need to....
dont wanna dota.. no mood todo so...
its too cold to wank.. nor do i feel like doing so....
im hungry, but theres absolutely nothing to eat at home at the moment...
im thirsty, i want water, yet the walk to the nearest water source seems like it'll take forever, not to mention the cold corridors......
theres nobody interesting on MSN.. nor am i in the mood for a chat...
hownow? browncow

- sorry Nat, i was kinda sickly, so i couldnt make it to sebun. When r ya flying off? we'll meet for lunch instead.. or.. koko black??

- sorry Sky, (read reason above). See u at another club, owh yeah, merdeka.. u doing anything???

- Countdown @ Velour then party @ Shamiana??? OR Countdown @ Shamiana then party @ Velour?? urgh urgh.. which has the hotter crowd? V(^_^)V decisions decisions.....

- sooo sick, my world is now devoid of taste and smell... i cant even sniff my whiskey.... and and i jusssttt figured how to prepare Zaru Soba, yet i cant fully enjoy the taste :S but... if theres one thing i wanna smell.. its you.. if theres one thing i wanna taste right now.. it... would be .. you... you yess you....

- i should sleep.. soccer 2moro..

- i need a hug. someone. huggles? puhlease? hahahahaa

- dammit i sound pathetic... tch...

Random Pictures to Scar Your Memory 2

2007-08-21T21:45:00.000-07:00

Got bored, browsing tru my picture folders. Hither are some of the pics. Enjoy :P
Owh, and maybe... one video... but I WILL KILL ANYONE WHO LAUGHS AT ME!!!

Click to Expand/Collapse entire entry

Once Upon A Time

2007-08-18T19:58:00.000-07:00

There was once an artist, who, on a blank canvas,
painted a magnificent picture.
T'was, what many, including himself,
deem as his greatest masterpiece.
And lo! he became obsessed with it!
staring at it excessively as time passes on.
The more he looked at the picture,
the more he felt the need to correct brushstrokes
and add fine touches to it.
And so.. he did, relentlessly.

Alas, the more improvisions he made,
the uglier the outcome.
Soon, it came to him that the additions were only defiling the original work.
So he removed, erased and re-painted parts.
In time, what was once a great piece of art, became something unrecognisable, somehing ugly and unsightly.
What was left is a canvas, tattered and ruined.
Colours.. dark and intertwined.

Too late it was, for the turn back. Too much it was, damaged to heal.
Such were his final realizations.
So now it lies, as a pile a scrap,
in oblivion with the rest of the failed works.
A new canvas? perhaps... a new inspiration?? in due time...
but heart he has no more.....

-WilZC-

*picture taken from tina's

Post One O One!!!

2007-08-15T07:29:00.000-07:00

Woo.. tis post numberrr 101!!! nicenice....
to commemorate this 'event' i'll post a mega entry filled wif naked pictures of myself!!

Click to Expand/Collapse entire entry

Laughter, the best medicine =D

2007-08-13T07:12:00.000-07:00

Click to Expand/Collapse entire entry

TESTS TESTS TESTS!!

2007-08-12T09:41:00.000-07:00

Got bored today, inbetween watching soccer, i took a few tests just to kill time. First one is a personality test, then i tried the quiz found on the Mensa website. Scored 23/30 (skipping one fucking question, coz i cbf finding a pen and paper). So? am i mensa material? ahahah who cares. I remember having a convo wif YK about mensa, cant remember if he really did join.

Heres the results for the other test.

Wish i.. could have.... a va gi naaaaaa

2007-08-08T04:30:00.000-07:00

ahahaaa.. this is fucking funny.. its soo funny its not funny.. hahahahha
thnx to eunice for the linky

Blurts

2007-08-07T05:10:00.000-07:00

Click to Expand/Collapse entire entry

RMITFORYOU.com

2007-08-06T02:03:00.000-07:00

Click to Expand/Collapse entire entry

Did You Know?

2007-08-04T23:20:00.000-07:00

Click to Expand/Collapse entire entry

Snowboarding @ Falls Creek

2007-08-02T03:25:00.000-07:00

Click to Expand/Collapse entire entry

of entries and exits...

2007-08-01T10:12:00.000-07:00

...............
you wanted to get out...
so you walked out the door...
and i closed it shut behind you.... reluctantly
and... yet ... the next time the door inches open..
you'd walk right in....

now...

i walked you out the door...
then i slammed it shut... locked it..
and threw the key away...
yet now.. u come knocking on my door.. again...

whither wilt this road taketh us?
whither wilt thou goest?

Happy Belated 21st Burfday Pei Lin

2007-08-01T08:20:00.000-07:00

Me and my darling birthday girl
(yes, this was on the 28th of June long time ago, hence my still long hair)

tis here tis here! the pictures!!...
and so i'll start with Pei Lin's 21st birthday!! :D who is she??? shes my dearest cousin! First of all, she is my closest kin, in the lands downunder. Secondly she is my closest friend and confidante. I've spent my entire life with her, since before i knew how to walk, to talk, then to pre-school, primary, highschool, college and now.. melbourne. We were cousins, neighbours, classmates, rivals, collegues, partners and best of friends. Twenty one years now u have lived, and im a few months behind :D. Twenty one years you have endured me, and i have endured u :P. And i'll continue to be around, im sure, for as long as i am fleshbound, we'll hit a century together perhaps, and then we'll look back at the past :D. You're one of the best ever things that have happened to me and you'll continue to be one of the closest beings i have to the heart, one i'll gladly take a bullet for. And i love you.. and you're 21... so now go get laid....

Groupshot mischief! me with the hammer!! rawr!!! and micelle has forks on my head!
(Clockwise from top left: Michael, Andy *top*, Han *bottom*, Myself, Michelle, Daniel, Tina, Cantremember1, Cantrememeber 2, Nichola, Hui Ching, Peilin, Jean and Tracy)

Groupshot mischeif! OUCH MAN FUCKING HELL!! Daniel stopped me from hammering burfdaygirl by pinching my nipples!!! and michelle looks like shes got her forks up my arse!!

Me n my fav melbourne girls, from left, Tina (whoz no longer a melbourne girl), Peilin, Tracy, and Nic.

Meet The Cousins! Me, Pei Lin, Daniel our big Bro

The boiz

Nintendo Wii slumber partaay afterwards. I had videos.. but its 2am in the morning.. lazy 2 convert them and post them up :P

More Fillers!!

2007-08-01T00:06:00.000-07:00

Show/Hide Entry

Filler Posts?

2007-07-30T19:56:00.000-07:00

Show/Hide Entry

Back... n dead tired...

2007-07-29T05:39:00.001-07:00

will.... kill... for a body massage...

To the mountains!!!

2007-07-25T11:25:00.000-07:00

Off I go!!
to the snow, to the snow!!

Heh, its about time i took some time off...
hopefully.. it'll be soo much fun it'll take my mind off... these really tumulteous times

All that one can see

2007-07-23T23:27:00.000-07:00

The eye perceives what the mind wants to see...
Now.. if one is'nt mindful,
then the mind perceives what the heart wants to see...
And the human heart, empowering our passions,
is both one's greatest strength and weaknness...

so...

Walk the dog, not let the dog walk thee.
Sail the winds, not let the winds sail thee.
Mind thy heart, and let not thy heart.. mind thee.

- WilZC -

But right now.. everything you want is wrong..

2007-07-22T21:21:00.000-07:00

found this on youtube.. amusing really...
got a.. love-hate relationship wif this though ...:S
love it.... hate it... tchhhhh

Joseph Arthur - Honey & the Moon

- Don't know why I'm still afraid, If you weren't real I would make you up

- I wish that I could follow through, I know that your love is true

- But right now, Everything you want is wrong,

- Remember when we first met, And everything was still a bet, in love's game
You would call; I'd call you back
And then I'd leave a message on your answering machine

- I think that you came too soon

- Ever since I've been with you,
You hold me up all the time I've fallen down

Hair on, Hair off

2007-07-21T00:53:00.000-07:00

Meh.. i want my long hair back!!!!
life's never the same now :(
but then again, im gonna shave bald before i head back 2 malaysia..
which actually means that... it'll be..
quite some time before my hair would be back to its lovely.. length...

Weee just woke up! pardon the bad hair
pic taken like 5secs ago :P
cant imagine how i'd look like bald tho :S

This was taken coz i was trying 2 prove to Jo-Leen that i look like Jet Li
pic was taken few days after i got my hair cut

Before i got dressed.. to get my hair cut..

Nyehehehe camwhoring trying 2 look like Mr. Kisuke
OKAY OKAY!! im 21!! gimme a break!! kid at heart!

Urahara Kisuke

Tch!!

2007-07-19T11:52:00.000-07:00

When i woke up today.. i felt really unfit, and so i promised myself i'd work out before i took a shower.... i didnt..

After i had lunch, i made a point to myself that in an hour or so, just when my lunch settled, or before dinner, i'd work out........ i didnt...

While having dinner, again, i made a mental note to myself '3-4 hours after food, i should work out... just before i shower n sleep'..... i didnt...

Now.. its 4:55am in the morning... i......... should work out...

NAAAAAAAAAAAHH.......

Unintended

2007-07-19T10:06:00.000-07:00

Sigh... sleeping times are a lil messed up at the moment... :S Tracy slept over last nite and she was coughing badly, couldnt sleep well coz i wus kinda worried but then she said its normal. Then! slept all night today and its 3am now and im wide awake... so.. clickety click and away we go!!!

Eversince i heard this song for the first time, i cant remember where, i think t'was YL's blog but yeah, its now become my like #1 emo song hahaha. Gonna list down a few amusing covers ive seen n heard on youtube.

Amusing.... making me feel like doing my OWN cover of this song.. butttt... naaahh.... my falsetto will destroy the world ahahah. Sum1 ought to record me singin in the bathroom hahahahahha.

Muse - Unintended

Sweet girl. Can i have her msn contacts? :D hahaha

Cant seem to take my eyes off her emobrows. Quite a bad cover but who am i to comment..... Also think she's phillo, heavy accent there.

This guy looks dorky, but actually quite amusing stuff he pulled off... jadi la.. jadi!.. hahahah he actually did the falsetto parts better then the girls above.

And now for some heavy foreign accent. But the guitar pluckings are dam crisp.. bleh.. if only i can play like dat....

Now.. for my very own cover.... no laughing!!!

Random

2007-07-16T07:40:00.000-07:00

When i was a kid, during art sessions where we were asked to draw 'what we wanna be' when we grow up... peers would draw all sortsa stuff, from policemen, firemen, soldiers, ballerinas beauty queens, nurses and doctors, yada yada yada .... As for me? i would draw myself, handsome as can be =P , in white labcoats, holding test tubes with weird colours. And that was my vision, my childhood goal... and it stuck on to me. My handwork would mature, as i draw better looking pictures of me in labcoat, but the labcoat remains, from preschool, primary, and well.. even highschool. Back then, i was an avid reader, an Encyclopedia whore. I was a walking Discovery Channel, reading new things everyday about science, technology as well as biology and animals. I was rather quite fond of animals, the fastest, the longest, the biggest, the fiercest, the smartest and so on.. i'd know them all.

Fast forward a good fifteen years. Im hitting 21years of age, 7000miles away from my family, in a room, my room, its now where i call home, home far away from home. Cozy yet its cold outside, very, and Linda is doing just well enough to warm me up, though im not impressed (will return her to Aris tomorrow). Piles of clean laundy stack right behind me, loose coins all over the place, havent shaved in a week, hair unkempt, the shirt i wear still smells of perfume, alchohol and cigarettes from clubbing a few nights ago (i actually like that combination of scents so i reuse the shirts as long as i can huahuahua). My bed is a mess, used jeans on the floor, bills and receipts scattered everywhere, cookie crumbs by the table AND I.. i'm sitting here, ignoring those chores and blogging away. Im still interested in biology though, human biology, human females to be more exact. Chapter Three, human sexual reproduction.

Last i checked, im enrolled in a well known Australian university, nearing the completion of my bachelors degree, Bachelor of Applied Science in Biotechnology. A scientist! a scientist i say!! but really now... do i really want this? do i really know what todo with this? or is this just a subconscious inclination pathway that i have fore-built since i was a kid? Have i actually logically, feasibly thought about this? about my life, as a scientist! What will i do next? will this carry on and be the backbone of how my life will be for the next.. well twenty years or so? I am sooo lost, Mid-Uni life-Crisis i'd call it. I've heard many a few great stories about friend's friends, or friend's friend's friends, young enterpreneurs, barely 25, rich, unfuckingbelievably rich and successfull. They'd do things outta the norm, breakthrough and now, they're probably richer then my daddy, leading a lifestyle many only dream of. And im pretty sure my path wont ever look like theirs. Envious? hardly, in awe? maybe.. inspired, dont think so. But this just makes me look back (and forward) and ponder about the choices i have made and the roads ive travelled.. and of course.. the paths.. not taken...

For now though... i'll just.. soldier on... soldier on.... scientist I will be. Live ...and let live

2007-07-16T06:09:00.000-07:00

This is what you have to do : -
1. Put your music player on shuffle.
2. Press forward for each question.
3. Use the song title as the answer to the question even if it doesn't make sense. No cheating.
4. With the answers, give your own comments on how they relate to the questions.
5. Tag 5 people.

How are you feeling today?
Led Zeppelin - Stairway to Heaven
'Theres a lady whoz sure, all that glitters is gold, and shes buyin a stairway to heaven'

Will you get far in life?
Eric Clapton - My Father's Eyes
*HMMMMMMMMMMMMMMMMMMM.................

What is your best friend's theme song?
Tonic - The way she loves me
'If you could only see how blue, her eyes can be....'
*Owh.. god... heh.. to all my friends out there, really, im sorry but if u could only see, then u'll know why, i am this way...

What is the story of your life?
Snow Patrol - Chasing Cars
*OMG!! hahahahahah thats sad!!! this is sad! ahahhaha

What was high school like?
Nirvana - Lithium
*Errrr.. nono.. i can assure u highskule aint like that...

How can you get ahead in life?
Red Hot Chilli Peppers - Around the World
'All around the world, we can make time, rompin n stompin coz im in my prime'

What's the best thing about your friends?
Savage Garden - Truely Madly Deeply
V(^_^)V

Describe your grandparents.
Vertical Horizon - You Say

How's your life going?
Vitamin C - Graduation
SERIOUSLY SOMEBODY RIGGED MY PLAYLIST SHUFFLE THINGAMAGICKS!!! owh my god, i dont wanna graduate...

What song will they play at your funeral?
MetallicA - Fade to Black
*hoh..... the song itself is abit off for a funeral but the title....

Will you have a happy life?
U2 - Beautiful Day
owh.. cool.. really??.. i think think 'meme' is rigged... somehow... but im not complaining

What do your friends really think of you?
Rikki - Suteki Da Ne? (is'nt it wonderful?/beautiful?)

Do people secretly lust after you?
Muse - Unintended
'You, could be my unintended, choice to live my life extended.. you.. could be the one i'll always love..'
*ive alwayz wanted 2 make love with this song playing in the background...

How can you make yourself happy?
Rie Fu - Somebody's World

What should you do with your life?
Sarah McLachlan - World on Fire
*-_-"

Will you ever have children?
Eric Clapton - Tears in Heaven
*owh.. god.. this is wrong.. i mean.. this song.. Clapton wrote.. because........ of...

What song would you strip to?
Imogen Heap - Come here boy
*actually makes some sense if ima strip for a chick

What does your mum think of you?
Larc En Ciel - Driver's High
lol.. funny...

What is your deep, dark secret?
Ronan KEating - When you say nothing at all
*heh, another dead on coincidence....

What is your mortal enemy's theme song?
Vertical Horizon - All of you

What's your personality like?
Aqualung - Easier to lie
'To bear the weight, and push into the sky, its easier to lie, easier to lie'
*ahahahaha

What song will be played at your wedding?
Vertical Horizon - Best i ever had
*owh.. no.. this is more like a breakup song lar....

i'll tag nobody...
actually.. i'll tag
Tracy
YK
Edwan
Suey (who nvr comes hither anymore)

and

Tashna! i forgot! edit edit!

The Great Ocean Road (Continued)

2007-07-15T06:08:00.000-07:00

Part 3: The Apostles

Twelve there once were, when all was new
standing tall and mighty, 'gainst wind and tides
but who can withstand? strong as they are
the crushing blows of Father Time
one by one, they fall aground
Twelve there once were, now Seven remain....

- WilZC -

The Apostles

Carcass of the Apostle

From left: Yen Yen, KaWing, Ru, Sk and ME. Wah my eyes look freaky..

Cold cold cold..

Melb > Sydney

huu more mindless camwhoring

Part 4: Loch Ard wreck site, Graveyards and the journey home

Loch Ard was this 19th century merchant/transport ship that got wrecked by the rough seas and shorelines around this area. Theres also a graveyard for the dead sailors and passengers nearby. Hahhahah when we saw the graveyard we all bolted back into the car (t'was already nightfall).

Loch Ard wreck site

Urgh, whats this again cannot remember

Ka Wing acting perculiar

I think... theres sumtin wrong wif Ka Wing..

Down the Great Ocean Road

2007-07-15T01:01:00.001-07:00

Heh.. ok.. was too damn tired that time.. but yeah..
Finally got down that road, its nothing tooo spectacular larr but there are some pretty jaw-gaping sceneries and places. Went wif this DoTA friend of mine from Sydney.. he would only like to be referred to as GEEK (Ru), and his housemate SK, and an his friends KW and YYen (couples). Fucking.. 3 hour drive... just to get there? thats like a trip to Penang.. :S. Best part is, we cant speed coz the limits are around 40-50kph and the roads are pretty windy (not sure if windy is the word for it but yeah gimme a break).

Singing in the car while every1 shut me off using earplugs

So.. i use visual aids to annoy them instead!

Part One: Boyband Album Photoshoot

Front Cover (Clockwise from ME!!, ME -> SK -> KaWing -> Ru)

Back

Alternate Front Cover (for sale in lala/ah-beng countries)

Part Two: The Otway Fly

This walkway is 600m long, and is elevated about 30m-40m off the ground, on the treetops of Beech Forest. It sounds cool, but really, its a loooong walk, not on the walk, but the muddy walk to GET to the beginning of it. And.. Yuki, the dog, was shaken by the height, so we had to carry him. Basically, just a look-see look-see and camwhore place. Weather was cold as hell.
PARDON THE CORNY SCREEN CAPS!!! i was bored...

Journey to the Tower of Doom begins

Our journey led us to two paths

Alas, after a long hard journey, we reached the Tower

Choco-Yuki, the guardian of the Flyway, blocks the path to the Tower (paws covered in choco-like mud)

Towertop, after subdueing Choco-Yuki and rescuing the Damsel-in-the-not-so-distress (YYen)

To be continued..... Part 3: The 12 Apostles

The Great Ocean Road

2007-07-14T12:24:00.001-07:00

So.. finally.. after 3 years in Melb, i've decided to take the road many has taken before... down the great ocean road......
...........................................
..........................................
...........................................
*falls asleep*

Meet Samuel!

2007-07-12T22:27:00.000-07:00

Got bored again, urgh raining again this morning, spent hours on the bed contemplating life and times. Then sammy came in! attention whore licking me all over so .. well.. took out d cam and started a mini photoshoot.

Hullo there!!

Stop looking elsewhere!!

Is this your kawaii pose?

Finally .. looking into the lens

Huh? what?

My Heritage (Celeb Lookalike)

2007-07-11T22:55:00.000-07:00

Bored... spent a whole hour playing wif this thingy.. roflol!! its quite fun!!
So, among the faces, Dalai Lama? :D PAVEL NEDVED!!! BoA and.. Ayumi Hamasaki? roflol

I also took the liberty to toy around wif pics of my other friends...

Pei Lin, dearest darlin cousin

Tina, housemate of 2 years... lol she got the dalai lama as well!!

Tracy, dear dear friend. And she looks like jackie chan.. :D (funny how both tracy n peilin got Ryoko Hirosue)

Aris, my housemate. John Woo!! anybody?

Ken Han. Bae Yong Jun

Daniel, big bro.

Jo-Leen, ol time friend, Halle Berry it seems

Steph, my ex from a long time ago (had a pic lingering around). And all her matches are over 80%!?

Mattasan!!!! {Myheritage.com: Sorry, no faces were detected, Click here to try again}

Why?

2007-07-08T07:59:00.000-07:00

Why?
why do humans, me, in particular, get so easily attracted, intrigued and enthralled by things which are deemed... well... forbidden... untouchable.. and unattainable.. To me, anything with [DO NOT TOUCH] labelled all over seems more like [COME HITHER BOY]. And its not as if i dont know any better.. i DO know!.. im smart enough to know, i already know actually.. that i should avoid these things.. but why? but how? i need 2 start thinking straight. Actually i am, i just need to put thoughts to actions. Human.. HUMAN!!.. wat is human? is this human?

Quoting Liu Bei's advisor from the book 'Romance of the Three Kingdoms' "The worst kind of men arent those who lets wrongdoings happen without knowing it but those that realise the wrongs but cannot do anything to correct them" (commenting on Liu Biao on his inability to stop his liutenants from abusing power and terrorizing the Jingzhou stately affairs). Best part is, amazingly i remmeber this shiz... the last time i read the book was when i was 15?? owh nostalgia... i wonder where that book is now....

siderant1: wahh.. cannot take it, back 2 back clubbing nights.. then basketball... wooo and somehow im still awake at this hour, albeit rather very sleepy... got a massive hangover when i woke up this morning, felt like puking, but was too sleepy 2 walk 2 the toilet....

ps1: pei lin puked, too much alchohol, then Willie, bought her the Coup De Grace, the Green Fairy, who danced like a pixie in her tummy n head.

For this picture, i'll be castrated.. and violated in ways i cannot imagine

siderant2: Im broke!! yet again!! farking spent heaps on mindless shopping, then friends came down from Sydney, and so brought them around and indulged with them. After wasting 40bucks (RM120) on a rather mediocre tasting steak, the final blow has been dealt, i'll be feeding on nothing that'll cost more then 4dollars a meal. But im done with instant noodlums.. any other suggestions??

Shopping and camwhoring.. man... bad influence from fellow bloggers :S

As a being made of pure narcissism, it didnt take too long before...

Siderant3: CANT WAIT FOR THE SKI TRIP!!! i've been very busy with 'life' these few days, and and this will be the icing on the cake, the diamond on the tiara, the mole on the face, the eye of london in malaysia. First tho, need to do heaps of squats, coz according to Master Teo, thigh strength is important, and fitness levels should be peak to enjoy the ski/snowboarding. Time to obtain them thunderthighs...

Siderant4: CUT MY HAIR!! omg! i look soo korean!! blardy koreans!! they made me look like one of 'em!! best part is!! Tracy recommeded me this shop coz i hate those FoB's claiming that this saloon is purely ABC, but no! alas, theyre 100% fresh korean importss!! they cant understand a word!! the shampoo girl took, or rather i took 5mins to process what shes trying to tell me 'Theres no more hot water, so the water will be a lil cold, is that ok?'. And the main hair dresser, lets not even start wif d guy.. he got the counter lady to speak to me as translator, and best part is, i cant understand the counter lady, nor can she really understand me.

ps2: After the haircut, they even got me to fill in this form so i can be a member...
little did they know.... {continue with your own ending of the story here}

siderant5: IF ONLY!! momma didnt throw away all my Transformers toys when hair started growing outta my armpits!! (and privates but lets not continue about that) I'd be rich selling them off at eBay!!!!!!!!!

Koko Black

2007-07-03T23:00:00.000-07:00

Sorry for bad camera quality :S

Ooo.. to reward myself.. or rather to compensate for an entire day of officiating basketball games for MASCA, i went to Koko Black to grab some truffles and pralines.. and they hit the spot really.. bullseye!! These are my two favourites... the Hazelnut Crisp and the Hazelnut Clusters.

The HCrisp is a cuboidal chocolate with a sprinkle of thin wafers on its coating of either dark or milk chocolate. Filled inside the choc is an incredibly smooth hazelnut praline paste, also with a slight hint of crispy wafers that would tingle senses in your oral cavity as you bite into the chocolate, sending signals that would induce the release of endorphins that can be rather.. orgasmic...

The HClusters are less.. of an adventure, more indulgence. Three pieces of the most fragrant hazelnuts caramelized then placed on fine belgian gianduja and coated with either dark or milk chocolate. The ultimate nut-lovers choc. The aroma of the hazelnuts blended with the chocolate coating, then comes the smooth gianduja texture, almost heavenly, making you wish the bite would never end.

Hot chocolate accompanied by a 'Belgian Spoil' tray.

The hot chocolate served here, i daresay are the best in the world. Made from geniune belgian chocolate, not powdered, but real chocolate shavings. The presentation of the choc drink itself is almost too nice, i find it hard to bring myself to stir it. Downing the hot liquid makes one feel warm and happy inside, especially during winter. The iced chocolate drink, the cold version of the hot chocolate, is pretty much fantastic as well! The cup is littered with chocolate shavings and a scoop of vanilla ice cream is found in the center of the drink. Some complain that these drinks are waaaaay to 'chocolatey' for their liking but, unfortunately in my world, theres never too much chocolate.

You Fool!!

2007-06-29T08:12:00.000-07:00

hey you!
who me?
yes you!
me wha?
you fool

=(

Impure Intentions...

2007-06-29T07:54:00.001-07:00

sigh...
tina's gone.. i didnt even wish her a proper goodbye...
i'll do a big post on that sooon....
My dearest cousin of all.. had her 21st...
will post on that soon too.......
but now........
now im just soooooooooooooooooooo miserable...
its like the whole world crumbled... shattered and torn...
grey.... pale...
decided i have, to keep it locked away, safe, and out of reach...
yet my resolve.. is sooo weak... so so weak...
and ............
owh..
i dont know.......... what to do.......... you... yes YOU and you know who...
you will be very dissapointed with me... with what ive done...
in fact.. i am too... but nay.. i just couldnt...
she tugged me, she grabbed my hand... ive never seen her this drunk before...
yet for that two seconds, her eyes seem sober.. more so then mine... and i was the sober one................
and she said 'dont go, dont do it, let it go... just let it go'
but i went................. n walked out..
and by doing so.. ive wrong'ed more than half the world...
ive done tina great injustice, and i want to hug her once more.. just once more..
ive done upon pei lin much wrong.. for walking off as she begged me to stay..
ive done myself (since im half my world) great wrong.... for doing what should not have been done...
in fact.. my actions are just.. rash.. impulsive.. carnal??
and because of that.. misery, despair...
i dunno.............. and Master Still Water muddles up the pond again...

Boredom leads to youtube

2007-06-25T22:54:00.000-07:00

'almost, ahahah almost, ahhaha'
i can watch this over.. and over again.. and still laugh..

This is the legendary clip, the one and only.. the greatest....
*introduced by darlin tracy

Shrek3, and a chilly day out

2007-06-23T23:10:00.000-07:00

Finally got to watch S3. Cheaparse tickets coz its some family screening courtesy of Daniel's workplace. Meaning? kids, families, and more kids.. in fact, its swarming wif kiddos... and tracy hates kiddos.. quote 'u know your dislike for using public toilet to poop? yeah thats kinda the same level i have with kids' hahah wtf..
but it was a fun watch... really..

after shrek though, i really had a thought about fat/ugly ppl sex, as in, hmm...
mannn.. i wouldnt do it wif a fat ogre, not with a million bucks to cash for... so.. this LOVE thingy really exist eh?? that, or mebbe coz the other half is desperate coz he/she is too ugly 2 get it from anyone else.. mebbe im just mean..
but really, when ur fugly, ur fugly, and no, nobody will see u as a looker. Its only because your inner self is so beautiful then some can overlook that outer shell you live in to reallly like you. 'Beauty is in the eye of the beholder' doesnt always hold true, because beauty itself is a subjective term. And so when girls ask their respective partners 'hey, does my arse look fat in this' the answer isnt yes, nor is it no, but rather it should be... i dont care, i love you. Because fiona's arse is rather fat.... :S and yes, im an ogre inside me *swings head around to fly my long messy hair*

Well then, after that, shopping beckons! i was really up for some massive purchasing, but, time did not permit me. We only had an hour to shop before DFO closes, that sux, bought a beanie... thats all.. and most of the time, i was a permanent fixture outside dressing rooms carrying plastic bags.

Got really bored, so i practiced the special.. 'Covert Camwhoring' techniques

This one's even better, hahaha u almost cant see the cam

I wonder why im not smiling for the camera ahhaha!, mebbe im trying to look nonchalant because im after all, doing some ninja-camwhoring.

Then for some unknown reason, we walked in the blistering cold to docklands, for nothing. Mebbe take a few snaps, thats all... pffft... shcooo cold!! i didnt bring a jacket!!! and didnt buy one!!

Looking gay, but owh what the hell, no other pictures

Shrek wannabe's

Playoffs 2007 Gallery

2007-06-22T15:01:00.000-07:00

Congratulations, San Antonio Spurs, yet again... NBA champs 2007

Duncan the main man on the left, and MVP Tony Parker

Playoff Final's Most Valuable Player Tony Parker, and his fiancee, Eva Longoria

Hmm... ive found pics of the playoff halftime dancers sooo lets review them instead!! V(^_^)V

Hmmm this might be why the spurs won, mann hawt...

whoah....

These are the girls that makes Yao Ming's 'rocket' go high (pun intended)

Kobe Bryant's girls...

Holy cow theyre fugly, get them outta here... look at the costume!! its ... an abomination...

Ever wondered why the pistons couldnt make it? their dancer's face looked like she got rammed by a truck down at the motor city(detroit)

Mann, theres just something about tied up white tees with short denim skirts/pants that jussssstttt turns me on... and ive no idea which team this is ... but i dont care

Post-NBA Playoffs 2007 awards...

2007-06-21T09:27:00.000-07:00

Taken and edited from Charlie Rosen's Mailbag

Tight Collar Award — To Vince Carter, for choking throughout the Nets-Cleveland series, especially in clutch situations.

Miss Manners Etiquette Award — To Jason Kidd, for being the only player in the NBA who always thanks the bench attendants for handing him a towel when he comes out of a game and takes a seat.

Coulda-Shoulda-Woulda Award — To the multitude of Phoenix Suns' partisans, who still believe that David Stern's unjust ruling to suspend Amare Stoudemire and Boris Diaw was the only reason the Spurs won the series. First of all, while Robert Horry's body-check was unnecessary, its severity was considerably enhanced by Steve Nash's arm-flapping-foot-flailing antics. In truth, the impact was nowhere near as dramatic nor as damaging as Nash's histrionics made it appear to be.
Secondly, all of the blame goes to Stoudemire and Diaw for violating rules and procedures with which they were totally familiar. Besides, even with Stoudemire in the lineup the Spurs beat the Suns 3-2, and Phoenix was much more competitive in the game Stoudemire missed than in the team's other losses.

Exit Whining Award — Goes to Jerry West, for complaining that the Memphis Grizzlies, who had the league's worst regular season record, failed to get either of the first two draft picks. West is advised to look at the final regular-season standings in the 2005-06 season, wherein the Blazers had the NBA's worst record, were ping-ponged into the fourth slot, and still managed to wind up with Rookie of the Year Brandon Roy.

Cry-Me-A-River Award — Andrei Kirilenko, for crying in front of his teammates because he felt that he hadn't received enough playing time in Utah's first playoff game versus the Rockets.

Dont-Fix-It-If-It-Ain't-Broken Award — Presented to Avery Johnson, for starting Dirk Nowitzki at center in the opening game of the Dallas-Golden State series. By so doing, Johnson sent the following message to his players: "What we've been doing all season long isn't good enough to beat the Warriors." Before a shot was fired, Johnson forced his players to doubt his credibility as well as their own collective self-esteem. This misbegotten move wasn't the primary reason the Mavs lost the series, but it surely didn't help.

Zen Koan Award — To Baron Davis, for making too much noise with two hands clapping.

Melvin Koznowski What-Me-Worry Award — Two winners on this one:
Vince Carter, for actually claiming after his pitiful performance against Cleveland that "Every shot I take is a good one."

Anderson Varejao, for stating that the foolish, embarrassing brick that he launched in the closing seconds of Game 3 of the Finals was also a good shot.

What's Foul Is Fair Award — Presented to Jim Clark, Bernie Fryer and Mark Wunderlich, for not exhaling through their whistles at the conclusion of Game 2 of the Cavs-Pistons series as LeBron James plowed through a welter of unfriendly limbs to shoot (and miss) a layup that might have won the game.
For sure there was contact on the play, the kind of contact that would constitute a foul in an Atlanta-Cleveland game in January. But not sufficient contact to decide the outcome of a playoff game.
Fouls, after all, are always relative.

Tic-Tac-Toe Award — Made to all those lightweight NBA fans, who believe that the Spurs are boring. Hopefully this award will enable them to differentiate between Xs and Os.

Brain-Dead-Gray-Matter Award — To Rasheed Wallace, for his shameful performances in Games 3 through 6 versus the Cavs. According to several widely respected neurologists, the gray spot atop Wallace's head is an indication that all the brain cells beneath it have been moribund for quite some time.

Paris Hilton Award — To Chris Duhon, for missing several team functions because he partied until the wee hours and over-slept. And then wondering why everybody thinks he's an airhead.

Tin-Man Award — To Dirk Nowitzki.

Empty

2007-06-20T10:37:00.000-07:00

:S
after the paperchase is over... im finally emancipated.. briefly that is... yet.. now.... life suddenly seems soo monotonous.. so .. empty...
when time is of essence!, every second is precious!!, leisure time becomes a luxury, and you feel guilty for 'indulging' in this extra wasted time... but somehow, i'd find the time and excuse todo the little things i do like blog n blogwhore, dota and basketball...

now that its over ... these things suddenly no longer appeal...
owh god... i feel like.... one of thoose grey elves from LOTR, immortal, thousands of years old... having lasted several aeons, they grow tired of this world, and travel.. to the west.... to the west (nobody knows whats there, mebbe big place wif hot chicks)

sigh... i need a spark... there hasnt been a spark in my eyes for quite some time now... i need .. a catalyst that would bring back that glow.. that spark.. that energy... that desire ... for anything at all... now.. which hardware store sells bright sparkly christmas lights?

2007-06-18T13:49:00.000-07:00

Music Video Codes

Five for Fighting - The Riddle (You & I)

Paperchase

2007-06-13T08:35:00.000-07:00

ah.. its been awhile since ive seen the light of day...
its been awhile since ive breathed the fresh morning air..
its been awhile since ive seen birds flying across blue skies..
its been awhile since... i've been alive...
all that paperchase... all that cramped up revisions...
and all that sleepless nights burning the midnight lamp all the way till daybreak..
almost as if i've made a pact with a powerful ethreal entity, borrowing time to make up for the 4 months of slacking...
ive been sleeping at 6am.. 7am.. and sometimes 11am.. in the morning... waking up at dinner time.. sometimes.. i wonder why.... i mean, i would have just about the same sleeping hours as an ordinary routine .. yet somehow i find it easier to read at wee hours... maybe.. maybe im just nocturnal..

the thingamagiks that kept me sane

whats worse? winter beckons.. colder then what memory would have known it to be... and with the rains at night and early morning drizzles, its almost a good thing i havent ventured out of the house just after sunrise. but no!, alas, for some reason, rmit is now using the MSAC sports centre as an exam venue! and so i'm dragging myself outta bed extra early, bathing in icy cold waters just to catch an early tram heading for the place, to finish of an examination paper in a large hall of a thousand heads. What could be worse? the hall is next to melbourne's largest indoor basketball facility, and from time to time, u'll hear the the basketball thumping on the hardwood, and a quick increase in the thumping rhythm would mean a crossover manouevre and a long pause.. would... signify a shot attempt... and soemtimes, i swear i hear the swishes but maybe thats all in my mind, the courts seeem hollow everytime i peek in post-exam time. i know.. i know... ppl tend to get distracted easier during times like these. halfway discribing the electron transport chain in photosynthesis, u'd pause and think about life, about laws of gravity, humanity (i'll quote this off jason lo) and ... that other thing bugging me ... =D what other thing?? owh.. you know.. THAT.. thing...

REGARDLESS.. on more paper to go... but i'll live life a day at a time....
*logs in to the gaming server*

Coming Soon!

One Two Three Drummond Street

The Prime Minister's Visit

2007-06-12T22:49:00.000-07:00

You're a song
Written by
The hands of God
Don't get me wrong
This might sound
To you a bit odd
But you're the place
Where all my thoughts
Go hiding
Right under your clothes
Is where I'll find them

More Labcoat Fun!!!

2007-05-28T11:14:00.000-07:00

Pushpa decided to bring her cam on our last lab session together.. and... guly's lust for the lens was already showing.. in fact... she almost couldnt hold back...

Me! with the RAWK t-shirt bought from S!impleCheryl's website (some charity thingy)

Miss Amengeldieva, Master Lim and Miss Gurung...

Me and guly.. (tsk tsk IMU labcoat)

err.. just.. guly.. what a poser.. :S

End-of-semester-camwhoring

2007-05-28T06:17:00.000-07:00

The last lab session of the first semester... and i finished my work and analysis in 5mins... thus i had all the time in the world to.. snap around ahhahaha...

My unknown speciment... took 2 weeks and 5 tests to identify it as Staphylococcus saphrophyticus... (although i could have done it in 3, but alphonse wants a minimum of 5 tests done)

fire.. ooo fire... wow...

Kriti, Chindu.. and .. i.. cant remember the guys name...

Mark and Phemelo

Alphonse, our lab instructor and a ... well.. student.. in a rather odd position

Alphonse's behind :D

Big Z

Zennan getting serious

How bizzare.. how bizzare.. how bizzare...

2007-05-27T11:25:00.000-07:00

during one of the more bizzare chats i've had in months...
with a friend of mine.... and...

Girl : i heard B is doing drugs
Me : big deal... i think thats an old story
Girl : nono, not weed, the stronger stuff...
Me : same thing...
Me : i fucked a girl....
Me : then i fucked a waaaaaayy hotter girl...
Me : so what...
Me : bottom line is.. i still fucked a girl..
Girl : hahaha okay...
Girl : i fucked GuyA
Girl : then i fucked his best friend B
Girl : THEN i fucked B's other best friend's brother!
Girl : i win... V(^_^)V
Me : devious... DEVIOUS!!!

and then we continued talking about breast implants and what size should she get...

Comfortably Numb

2007-05-21T00:54:00.000-07:00

Haihz.. its the exam month again..
and.. yet again.. im comfortably numb........
its like.. when you're soo numb, u dont feel anything...
and when sumbody pinches u hard, u feel nothing...
not the slightest of pain, but somehow you know, it should hurt..
and when the numbness recedes, the pain comes crashing down...

i should study... i am trying.. but not enough... i suppose..
i know i should take things seriously.. but i dont feel the anxiety...
and after the exams are over, and the results are out...
well.... we know the drill....

in fact, some of u should have heard this story.. many times over..

ON A TOTALLY DIFFERENT SUBJECT!!
taking a shower has been, and will be a pain for the next few days... theres been a leak somewhere, and so the plumbers are here to fix it.. to do so, they .. ripped the bloody wall down... and thus we're unable to use the shower :( for.. well a week or so..... how now? use the bathtub lor.... i mean, big bathtubs are kinky shiz n all.. but.. well... its pretty hard to.. get a shower in the bathtub... when ur nnot.. planning on taking the long soaking baths...
its rather pathetic hahaha, poor ol naked me crouching and sitting under the tap like a man whoz not touched water in 3 years.... trying 2 get my entire body wet n soaked with HOT water because the weather is so FUCKIGN COLD

The shower got terrorized by rowdy plumbers trying 2 fix a leak

The bathtub (i WOULD pose a shot with me in it taking a scrub, buttttt no cameraman larrr, any volunteers?)

Enter Still Water...

Much ado about nothing

HOLA!

PIKAPIKA!!!!!!!

Singapore Trip 2008!!

CNY Emergency!!!

Tal Ben-Haim

Randomness

Melancholic

:S

Timeout!! *PREEEET!*

Xmas 2007

Chronicles of Khoo Meng Tat's 21st birthday

Note!

The return!

i...........

Updates

tra la la la laaa

WHOOOAAH!!!

Come Fly with Me

\(^_^)/

The Need to Know!

NBA 2007-2008

Post-Exam Hiatus???

Happy Birthday to mee!! V(^_^)V

Loading and Saving..

why no updates???

Project Green Tea

The Kingdom

Green is in

Hide N Seek

I Dissapear

Dreams....

Only Thee

Jose Mourinho 2004-2007

Got Milk?

But its Mrs. Fields dammit...

Wooo...

.................

There is no such thing as shark attacks!!

LUST!!!

Football Manager 2007

The Mud Butt Chronicles

Bleh....

Random Pictures to Scar Your Memory 2

Once Upon A Time

Post One O One!!!

Laughter, the best medicine =D

TESTS TESTS TESTS!!

Wish i.. could have.... a va gi naaaaaa

Blurts

RMITFORYOU.com

Did You Know?

Snowboarding @ Falls Creek

of entries and exits...

Happy Belated 21st Burfday Pei Lin

More Fillers!!

Filler Posts?

Back... n dead tired...

To the mountains!!!

All that one can see

But right now.. everything you want is wrong..

Hair on, Hair off

Tch!!

Unintended

Random

The Great Ocean Road (Continued)

Down the Great Ocean Road

The Great Ocean Road

Meet Samuel!

My Heritage (Celeb Lookalike)

Why?

Koko Black

You Fool!!

Impure Intentions...

Boredom leads to youtube

Shrek3, and a chilly day out

Playoffs 2007 Gallery

Post-NBA Playoffs 2007 awards...

Empty

Timeout!! PREEEET!